Incidental Mutation 'R6057:Tbc1d4'
ID483003
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene NameTBC1 domain family, member 4
Synonyms5930406J04Rik, AS160
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location101442360-101609191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101489917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000097913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
Predicted Effect probably damaging
Transcript: ENSMUST00000100340
AA Change: V486A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: V486A

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect probably benign
Transcript: ENSMUST00000159664
SMART Domains Protein: ENSMUSP00000124734
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
SCOP:d1ddma_ 2 48 1e-6 SMART
Blast:PTB 2 58 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect unknown
Transcript: ENSMUST00000159951
AA Change: V198A
SMART Domains Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083
AA Change: V198A

DomainStartEndE-ValueType
PTB 28 170 8.6e-22 SMART
Pfam:DUF3350 459 522 2.3e-31 PFAM
TBC 574 794 5.2e-77 SMART
Blast:TBC 819 877 7e-24 BLAST
Blast:TBC 882 936 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect probably benign
Transcript: ENSMUST00000161991
AA Change: V486A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: V486A

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162617
AA Change: V486A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: V486A

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101608112 missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101444566 missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101449193 splice site probably benign
IGL01144:Tbc1d4 APN 14 101444663 missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101608015 missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101489864 nonsense probably null
IGL02177:Tbc1d4 APN 14 101454939 missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101465730 missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101501100 missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101458113 missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101458063 splice site probably null
R0787:Tbc1d4 UTSW 14 101449209 missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101479220 splice site probably benign
R1167:Tbc1d4 UTSW 14 101608019 missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101507106 missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101475215 missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101507138 missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101477155 missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101494411 missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101494361 missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101458755 missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101507213 missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101608336 missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101458783 missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101462827 intron probably benign
R4872:Tbc1d4 UTSW 14 101444708 missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101507231 missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101458882 nonsense probably null
R5180:Tbc1d4 UTSW 14 101507572 missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101607976 missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101455008 missense probably damaging 1.00
R6180:Tbc1d4 UTSW 14 101458770 missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101507174 missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101608318 missense possibly damaging 0.92
R6791:Tbc1d4 UTSW 14 101608259 missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101458749 missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101487441 missense probably damaging 1.00
Z1088:Tbc1d4 UTSW 14 101452423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAGCTAGATTTACATGTCC -3'
(R):5'- CTGTTCATGCTCCAGGGTTC -3'

Posted On2017-07-14