Incidental Mutation 'R6057:Myof'
ID483020
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 37926981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect probably null
Transcript: ENSMUST00000041475
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172095
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224518
Predicted Effect probably benign
Transcript: ENSMUST00000225159
Predicted Effect probably null
Transcript: ENSMUST00000226068
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTGCAGATCATCAATATGTTCCTGG -3'
(R):5'- CCATTCAAGTACTGTTTCGTGAG -3'

Posted On2017-07-14