Incidental Mutation 'R6057:Psd'
ID483022
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6057 (G1)
Quality Score207.009
Status Not validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46323314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000152942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026256] [ENSMUST00000041391] [ENSMUST00000096029] [ENSMUST00000177667] [ENSMUST00000223903] [ENSMUST00000223917] [ENSMUST00000224447] [ENSMUST00000225323] [ENSMUST00000225781]
Predicted Effect probably benign
Transcript: ENSMUST00000026256
SMART Domains Protein: ENSMUSP00000026256
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 1.9e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041391
AA Change: E309G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: E309G

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000096029
AA Change: E309G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: E309G

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177667
SMART Domains Protein: ENSMUSP00000137489
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 2.1e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223903
Predicted Effect probably benign
Transcript: ENSMUST00000223917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224444
Predicted Effect probably benign
Transcript: ENSMUST00000224447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225072
Predicted Effect possibly damaging
Transcript: ENSMUST00000225323
AA Change: E309G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225770
Predicted Effect probably benign
Transcript: ENSMUST00000225781
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
R7593:Psd UTSW 19 46312913 missense possibly damaging 0.47
R7614:Psd UTSW 19 46313438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTAGTCCCACTCACCGG -3'
(R):5'- ATCCAACATGACTTACCTCCTG -3'

Posted On2017-07-14