Incidental Mutation 'R6058:Hecw2'
ID483025
Institutional Source Beutler Lab
Gene Symbol Hecw2
Ensembl Gene ENSMUSG00000042807
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
SynonymsA730039N16Rik, Nedl2, D030049F17Rik
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R6058 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location53806876-54195168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53923976 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 792 (H792R)
Ref Sequence ENSEMBL: ENSMUSP00000113283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087659
AA Change: H792R

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: H792R

DomainStartEndE-ValueType
Pfam:HECW_N 45 164 4.6e-62 PFAM
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120904
AA Change: H792R

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: H792R

DomainStartEndE-ValueType
PDB:2LFE|A 42 162 6e-80 PDB
low complexity region 165 178 N/A INTRINSIC
C2 186 297 2.19e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 746 755 N/A INTRINSIC
low complexity region 769 786 N/A INTRINSIC
WW 814 846 1.21e-11 SMART
coiled coil region 853 880 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
WW 992 1024 2.12e-7 SMART
Blast:HECTc 1111 1183 2e-23 BLAST
HECTc 1241 1578 8.02e-183 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10031 T C 1: 156,524,855 Y209H probably damaging Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Hsd11b2 G T 8: 105,523,334 R359L possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mark4 T C 7: 19,426,385 E650G probably benign Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Vmn2r7 A T 3: 64,725,015 C9S probably benign Het
Xdh T A 17: 73,906,269 M829L probably damaging Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Hecw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Hecw2 APN 1 53830737 missense probably damaging 1.00
IGL00338:Hecw2 APN 1 53827881 splice site probably benign
IGL00530:Hecw2 APN 1 53853280 missense probably damaging 1.00
IGL01343:Hecw2 APN 1 53826976 missense probably damaging 0.96
IGL01503:Hecw2 APN 1 53826961 missense probably damaging 1.00
IGL01989:Hecw2 APN 1 53840792 missense probably damaging 1.00
IGL02016:Hecw2 APN 1 53831543 missense possibly damaging 0.73
IGL02052:Hecw2 APN 1 53926511 missense probably benign
IGL02085:Hecw2 APN 1 53942802 critical splice acceptor site probably null
IGL02302:Hecw2 APN 1 53933248 missense probably damaging 1.00
IGL02310:Hecw2 APN 1 53923916 missense probably null 0.38
IGL02388:Hecw2 APN 1 53925699 missense probably benign 0.17
IGL02499:Hecw2 APN 1 53926488 missense probably benign
IGL02695:Hecw2 APN 1 53926209 missense possibly damaging 0.94
IGL02732:Hecw2 APN 1 53926688 splice site probably benign
IGL03100:Hecw2 APN 1 53831656 missense probably damaging 1.00
IGL03175:Hecw2 APN 1 53926257 missense possibly damaging 0.51
IGL03253:Hecw2 APN 1 53832716 missense possibly damaging 0.85
IGL03356:Hecw2 APN 1 53927058 splice site probably benign
Memoriam UTSW 1 53926056 missense probably benign
recollect UTSW 1 53904422 missense possibly damaging 0.88
ANU74:Hecw2 UTSW 1 53925694 missense probably benign 0.01
R0077:Hecw2 UTSW 1 53868831 splice site probably benign
R0133:Hecw2 UTSW 1 53830740 missense probably damaging 1.00
R0268:Hecw2 UTSW 1 53926698 splice site probably benign
R1303:Hecw2 UTSW 1 54040393 missense probably benign 0.00
R1460:Hecw2 UTSW 1 53813245 missense probably damaging 0.96
R1524:Hecw2 UTSW 1 53851618 missense probably damaging 1.00
R1533:Hecw2 UTSW 1 53926545 unclassified probably null
R1828:Hecw2 UTSW 1 53926023 missense probably benign
R2170:Hecw2 UTSW 1 53942797 missense probably damaging 0.99
R2338:Hecw2 UTSW 1 53904422 missense possibly damaging 0.88
R3016:Hecw2 UTSW 1 53830680 missense probably damaging 1.00
R3872:Hecw2 UTSW 1 53832757 splice site probably benign
R3892:Hecw2 UTSW 1 53926121 missense probably benign 0.01
R4086:Hecw2 UTSW 1 53831656 missense probably damaging 1.00
R4247:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4248:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4249:Hecw2 UTSW 1 53832645 missense probably damaging 1.00
R4545:Hecw2 UTSW 1 53813222 makesense probably null
R4805:Hecw2 UTSW 1 53840859 missense probably damaging 1.00
R4834:Hecw2 UTSW 1 53830752 missense probably damaging 1.00
R4884:Hecw2 UTSW 1 53950841 missense probably benign 0.03
R4983:Hecw2 UTSW 1 53832671 missense probably benign 0.42
R5168:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
R5482:Hecw2 UTSW 1 53926201 missense probably benign 0.09
R5549:Hecw2 UTSW 1 53925691 missense possibly damaging 0.91
R5623:Hecw2 UTSW 1 53832623 missense probably null 1.00
R5740:Hecw2 UTSW 1 53887603 missense probably benign 0.12
R5919:Hecw2 UTSW 1 53937090 missense probably damaging 0.99
R6460:Hecw2 UTSW 1 53868833 splice site probably null
R6875:Hecw2 UTSW 1 53937132 missense probably benign 0.01
R7097:Hecw2 UTSW 1 53865124 missense possibly damaging 0.88
R7131:Hecw2 UTSW 1 53865121 missense probably damaging 1.00
R7291:Hecw2 UTSW 1 53914594 missense probably damaging 1.00
R7401:Hecw2 UTSW 1 53904343 missense probably damaging 1.00
R7482:Hecw2 UTSW 1 54040470 missense probably damaging 0.99
R7501:Hecw2 UTSW 1 53913872 critical splice acceptor site probably null
R7520:Hecw2 UTSW 1 53926056 missense probably benign
R7611:Hecw2 UTSW 1 53913300 missense probably damaging 1.00
Z1177:Hecw2 UTSW 1 53923943 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGACACCTTCTTCTCCAGG -3'
(R):5'- CAGCCTTGGAACTGATGTTTG -3'

Sequencing Primer
(F):5'- TTCTTCTCCAGGAACCAGGGAAAG -3'
(R):5'- CCTATCCTAGGTGTGTGTTT -3'
Posted On2017-07-14