Incidental Mutation 'R6058:Gm10031'
ID483032
Institutional Source Beutler Lab
Gene Symbol Gm10031
Ensembl Gene ENSMUSG00000101523
Gene Namepredicted pseudogene 10031
Synonyms
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6058 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156524012-156526664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156524855 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 209 (Y209H)
Ref Sequence ENSEMBL: ENSMUSP00000140515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190422]
Predicted Effect probably damaging
Transcript: ENSMUST00000190422
AA Change: Y209H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140515
Gene: ENSMUSG00000101523
AA Change: Y209H

DomainStartEndE-ValueType
S_TKc 39 324 1.88e-78 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hecw2 T C 1: 53,923,976 H792R possibly damaging Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Hsd11b2 G T 8: 105,523,334 R359L possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mark4 T C 7: 19,426,385 E650G probably benign Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Vmn2r7 A T 3: 64,725,015 C9S probably benign Het
Xdh T A 17: 73,906,269 M829L probably damaging Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Gm10031
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03394:Gm10031 APN 1 156525222 missense probably benign 0.34
R5578:Gm10031 UTSW 1 156525230 missense probably benign
R6249:Gm10031 UTSW 1 156525230 missense probably benign
R6965:Gm10031 UTSW 1 156524549 nonsense probably null
R7514:Gm10031 UTSW 1 156524754 missense probably benign 0.05
R7761:Gm10031 UTSW 1 156525137 nonsense probably null
R7765:Gm10031 UTSW 1 156524784 missense possibly damaging 0.47
R7782:Gm10031 UTSW 1 156524982 missense probably damaging 1.00
R7889:Gm10031 UTSW 1 156525395 missense probably benign
R7972:Gm10031 UTSW 1 156525395 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGATTATTGTCACAGCATGGG -3'
(R):5'- GGAGTGTCTGCCCAAGATATCG -3'

Sequencing Primer
(F):5'- ATTGTCACAGCATGGGGATTATG -3'
(R):5'- GTCTGCCCAAGATATCGTTGAAACG -3'
Posted On2017-07-14