Incidental Mutation 'R6058:Vmn2r7'
ID483039
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6058 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64725015 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 9 (C9S)
Ref Sequence ENSEMBL: ENSMUSP00000124192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050123
Predicted Effect probably benign
Transcript: ENSMUST00000161972
AA Change: C9S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: C9S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10031 T C 1: 156,524,855 Y209H probably damaging Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hecw2 T C 1: 53,923,976 H792R possibly damaging Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Hsd11b2 G T 8: 105,523,334 R359L possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mark4 T C 7: 19,426,385 E650G probably benign Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Xdh T A 17: 73,906,269 M829L probably damaging Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCACTTGTTGGCATGGTCC -3'
(R):5'- AGAGTGTTGCTCAGCTCCTATTC -3'

Sequencing Primer
(F):5'- GTTGGCATGGTCCTATAATGAACAG -3'
(R):5'- CCATAAATTGCAAGTGACTGTGAC -3'
Posted On2017-07-14