Incidental Mutation 'R6058:Mark4'
ID483049
Institutional Source Beutler Lab
Gene Symbol Mark4
Ensembl Gene ENSMUSG00000030397
Gene NameMAP/microtubule affinity regulating kinase 4
SynonymsMarkl1, 2410090P21Rik
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6058 (G1)
Quality Score202.009
Status Not validated
Chromosome7
Chromosomal Location19424775-19458821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19426385 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 650 (E650G)
Ref Sequence ENSEMBL: ENSMUSP00000082862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003643] [ENSMUST00000085715] [ENSMUST00000208710] [ENSMUST00000209058]
Predicted Effect probably benign
Transcript: ENSMUST00000003643
SMART Domains Protein: ENSMUSP00000003643
Gene: ENSMUSG00000030399

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 5.2e-38 PFAM
Pfam:ATP-gua_Ptrans 120 367 2.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000047020
SMART Domains Protein: ENSMUSP00000043987
Gene: ENSMUSG00000040705

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085715
AA Change: E650G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397
AA Change: E650G

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208685
Predicted Effect probably benign
Transcript: ENSMUST00000208710
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit insulin hypersensitivity and resistance to diet-induced obersity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10031 T C 1: 156,524,855 Y209H probably damaging Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hecw2 T C 1: 53,923,976 H792R possibly damaging Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Hsd11b2 G T 8: 105,523,334 R359L possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Vmn2r7 A T 3: 64,725,015 C9S probably benign Het
Xdh T A 17: 73,906,269 M829L probably damaging Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Mark4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mark4 APN 7 19431824 missense possibly damaging 0.50
IGL02321:Mark4 APN 7 19426389 missense probably benign
IGL02813:Mark4 APN 7 19447256 splice site probably null
IGL03088:Mark4 APN 7 19451584 missense probably damaging 1.00
R0555:Mark4 UTSW 7 19448673 splice site probably benign
R1278:Mark4 UTSW 7 19431770 missense probably damaging 0.99
R1385:Mark4 UTSW 7 19426027 unclassified probably null
R3415:Mark4 UTSW 7 19451725 missense probably benign 0.00
R3828:Mark4 UTSW 7 19443187 missense possibly damaging 0.65
R4281:Mark4 UTSW 7 19433446 missense probably benign 0.09
R4682:Mark4 UTSW 7 19445172 splice site probably null
R4791:Mark4 UTSW 7 19451657 missense probably benign 0.19
R5184:Mark4 UTSW 7 19447243 missense possibly damaging 0.95
R5319:Mark4 UTSW 7 19436961 missense possibly damaging 0.95
R5330:Mark4 UTSW 7 19436983 missense probably damaging 1.00
R5488:Mark4 UTSW 7 19429607 splice site probably null
R5811:Mark4 UTSW 7 19448639 missense probably damaging 1.00
R6148:Mark4 UTSW 7 19429516 missense probably benign 0.00
R6333:Mark4 UTSW 7 19443283 missense probably damaging 0.98
R6698:Mark4 UTSW 7 19429437 missense probably benign 0.01
R7265:Mark4 UTSW 7 19451725 missense probably benign 0.00
R7429:Mark4 UTSW 7 19426167 missense probably damaging 0.99
R7664:Mark4 UTSW 7 19443226 missense probably damaging 1.00
R8027:Mark4 UTSW 7 19447239 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CACCTCCACTTCGAAATGGGAC -3'
(R):5'- TAGTGGCCAGCTTTCCTCTG -3'

Sequencing Primer
(F):5'- TGCAGGCAGGCCAGCAGGAACG -3'
(R):5'- TCTGTGAAGGAGATTACAGGAATC -3'
Posted On2017-07-14