Incidental Mutation 'R6058:Hsd11b2'
ID 483056
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Name hydroxysteroid 11-beta dehydrogenase 2
Synonyms 11HSD2, 11(beta)-HSD2
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6058 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105518755-105523988 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105523334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 359 (R359L)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]
AlphaFold P51661
Predicted Effect probably benign
Transcript: ENSMUST00000013304
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000034363
AA Change: R359L

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: R359L

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10031 T C 1: 156,524,855 Y209H probably damaging Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hecw2 T C 1: 53,923,976 H792R possibly damaging Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mark4 T C 7: 19,426,385 E650G probably benign Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Vmn2r7 A T 3: 64,725,015 C9S probably benign Het
Xdh T A 17: 73,906,269 M829L probably damaging Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 105523151 missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 105523166 missense probably benign
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R5780:Hsd11b2 UTSW 8 105522155 missense probably damaging 1.00
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 105518874 missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 105519103 missense possibly damaging 0.95
R8110:Hsd11b2 UTSW 8 105522634 missense probably damaging 0.98
R8889:Hsd11b2 UTSW 8 105522631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATTGAGCACGTGCACGG -3'
(R):5'- ACACAGACTCTAGGGTAAGGC -3'

Sequencing Primer
(F):5'- GGGCAGTTCCTGAATTCACTCAG -3'
(R):5'- TGTCTTAAGCAGGAGCAG -3'
Posted On 2017-07-14