Mutagenetix > Incidental Mutations

Incidental Mutation 'R6058:Hsd11b2'

483056

Institutional Source

Beutler Lab

Gene Symbol

Hsd11b2

Ensembl Gene

ENSMUSG00000031891

Gene Name

hydroxysteroid 11-beta dehydrogenase 2

Synonyms

11HSD2, 11(beta)-HSD2

MMRRC Submission

044224-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6058 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105518755-105523988 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 105523334 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 359 (R359L)

Ref Sequence

ENSEMBL: ENSMUSP00000034363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]

Predicted Effect

probably benign
Transcript: ENSMUST00000013304

SMART Domains

Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

Domain	Start	End	E-Value	Type
Pfam:vATP-synt_AC39	16	347	2.4e-116	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034363
AA Change: R359L

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: R359L

Domain	Start	End	E-Value	Type
low complexity region	11	32	N/A	INTRINSIC
low complexity region	34	44	N/A	INTRINSIC
low complexity region	51	65	N/A	INTRINSIC
Pfam:adh_short	83	278	9.2e-47	PFAM
Pfam:adh_short_C2	89	294	2e-11	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Adamts20	G	A	15: 94,330,047	R1040*	probably null	Het
Akt1	A	G	12: 112,662,200	L52P	probably damaging	Het
Alk	T	A	17: 71,869,747	T1521S	probably benign	Het
Armt1	A	G	10: 4,453,488	N191S	probably damaging	Het
Ascl1	T	G	10: 87,492,700	N130T	probably damaging	Het
Bahcc1	T	G	11: 120,287,385	S2257A	probably damaging	Het
Cd86	T	C	16: 36,629,015	M7V	possibly damaging	Het
Cep57	A	T	9: 13,810,761	S304R	possibly damaging	Het
Cep57l1	A	T	10: 41,740,922	I123N	possibly damaging	Het
Cers6	A	G	2: 68,861,664	N10S	probably benign	Het
Chrng	A	G	1: 87,211,352	D475G	probably damaging	Het
Crabp1	T	A	9: 54,772,845	V128E	probably damaging	Het
Dcdc2a	T	C	13: 25,056,371	V34A	possibly damaging	Het
Fam102a	G	A	2: 32,560,090	V117I	probably benign	Het
Fbn1	A	G	2: 125,466,612	C177R	possibly damaging	Het
Fras1	A	G	5: 96,709,985	D2046G	probably benign	Het
Glul	T	C	1: 153,907,341	I220T	probably benign	Het
Gm10031	T	C	1: 156,524,855	Y209H	probably damaging	Het
Gm10436	T	A	12: 88,177,225	I273F	possibly damaging	Het
Gpc6	C	T	14: 117,964,770	T464M	probably damaging	Het
Gpm6a	T	C	8: 55,058,798	S236P	probably damaging	Het
H2-K1	G	T	17: 33,999,330	T204K	probably benign	Het
H2-K1	T	C	17: 33,999,331	T204A	probably benign	Het
Hecw2	T	C	1: 53,923,976	H792R	possibly damaging	Het
Herc4	T	A	10: 63,275,042	I244K	possibly damaging	Het
Igsf9	G	A	1: 172,484,889	E56K	probably damaging	Het
Il9	T	C	13: 56,480,682	T65A	possibly damaging	Het
Kcnip1	T	C	11: 33,642,478	T102A	probably damaging	Het
L3mbtl2	T	C	15: 81,667,354	S74P	probably benign	Het
Lamc2	C	T	1: 153,136,829	D700N	probably benign	Het
Ldb2	T	C	5: 44,476,563	T322A	possibly damaging	Het
Lix1	A	T	17: 17,443,750	I117F	probably damaging	Het
Map2	T	A	1: 66,415,414	D1154E	probably benign	Het
Marco	A	T	1: 120,476,706	I425N	probably damaging	Het
Mark4	T	C	7: 19,426,385	E650G	probably benign	Het
Mink1	A	G	11: 70,611,720	T1086A	possibly damaging	Het
Nxf1	G	A	19: 8,767,822	V479M	probably damaging	Het
Olfr138	A	G	17: 38,275,259	T163A	probably damaging	Het
Olfr1420	T	A	19: 11,896,024	M1K	probably null	Het
Olfr191	T	C	16: 59,085,910	D191G	probably damaging	Het
Olfr191	A	G	16: 59,086,429	V18A	probably benign	Het
Olfr744	T	C	14: 50,618,701	F160L	probably benign	Het
Olfr774	T	C	10: 129,238,460	S104P	probably damaging	Het
Otx2	T	C	14: 48,658,758	D281G	probably damaging	Het
Pcdhga3	A	T	18: 37,675,088	D198V	probably damaging	Het
Ppp1r13l	T	C	7: 19,370,575	V273A	probably benign	Het
Ppp6r2	T	C	15: 89,253,252		probably null	Het
Prg4	C	T	1: 150,451,446	G873D	probably damaging	Het
Ptprq	T	C	10: 107,635,274	N1422S	probably benign	Het
Rbm27	A	T	18: 42,327,505	K839M	probably damaging	Het
Rere	A	T	4: 150,468,798	N149I	probably damaging	Het
Ret	A	G	6: 118,179,319	L340S	probably benign	Het
Sel1l2	T	A	2: 140,240,969	D583V	possibly damaging	Het
Shroom1	A	T	11: 53,463,481	D76V	possibly damaging	Het
Slc5a3	C	A	16: 92,079,075	S673R	probably benign	Het
Spink1	A	T	18: 43,728,182	I74N	probably damaging	Het
Tbc1d1	T	A	5: 64,278,009	S497T	probably damaging	Het
Trim3	C	T	7: 105,611,071	R741Q	probably damaging	Het
Ttn	A	G	2: 76,916,678	C4676R	probably benign	Het
Ubqlnl	G	A	7: 104,148,752	P513S	probably benign	Het
Unc13d	C	T	11: 116,073,568		probably null	Het
Vmn1r125	TGG	TG	7: 21,272,219		probably null	Het
Vmn2r7	A	T	3: 64,725,015	C9S	probably benign	Het
Xdh	T	A	17: 73,906,269	M829L	probably damaging	Het
Zcrb1	A	G	15: 93,387,582	F173L	probably benign	Het
Zfp41	T	C	15: 75,618,523	V108A	probably damaging	Het
Zfp438	T	C	18: 5,213,209	E583G	probably damaging	Het
Zfp628	T	C	7: 4,920,918	L713P	probably damaging	Het
Zfp664	T	A	5: 124,885,978	C145*	probably null	Het
Zfp683	T	C	4: 134,058,731	C390R	probably damaging	Het
Zfp941	G	A	7: 140,812,097	P450S	probably damaging	Het

Other mutations in Hsd11b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Hsd11b2	APN	8	105523127	missense	probably benign	0.06
IGL01620:Hsd11b2	APN	8	105522897	missense	probably benign	0.04
IGL02257:Hsd11b2	APN	8	105523222	missense	probably benign	0.04
IGL02655:Hsd11b2	APN	8	105522328	missense	probably benign	0.00
gilberto	UTSW	8	105523067	missense	possibly damaging	0.96
R0254:Hsd11b2	UTSW	8	105523067	missense	possibly damaging	0.96
R1082:Hsd11b2	UTSW	8	105523151	missense	probably damaging	0.99
R2050:Hsd11b2	UTSW	8	105523360	missense	probably benign	0.27
R4135:Hsd11b2	UTSW	8	105523166	missense	probably benign
R5294:Hsd11b2	UTSW	8	105523297	missense	probably benign	0.01
R5598:Hsd11b2	UTSW	8	105522511	missense	probably benign
R5780:Hsd11b2	UTSW	8	105522155	missense	probably damaging	1.00
R6867:Hsd11b2	UTSW	8	105522317	missense	probably benign	0.00
R7535:Hsd11b2	UTSW	8	105519123	missense	probably damaging	0.99
R7786:Hsd11b2	UTSW	8	105518874	missense	probably damaging	0.99
R8006:Hsd11b2	UTSW	8	105519103	missense	possibly damaging	0.95
R8110:Hsd11b2	UTSW	8	105522634	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TACATTGAGCACGTGCACGG -3'
(R):5'- ACACAGACTCTAGGGTAAGGC -3'

Sequencing Primer
(F):5'- GGGCAGTTCCTGAATTCACTCAG -3'
(R):5'- TGTCTTAAGCAGGAGCAG -3'

Posted On

2017-07-14