Incidental Mutation 'R6058:Xdh'
ID483093
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 044224-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R6058 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73906269 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 829 (M829L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: M829L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: M829L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Adamts20 G A 15: 94,330,047 R1040* probably null Het
Akt1 A G 12: 112,662,200 L52P probably damaging Het
Alk T A 17: 71,869,747 T1521S probably benign Het
Armt1 A G 10: 4,453,488 N191S probably damaging Het
Ascl1 T G 10: 87,492,700 N130T probably damaging Het
Bahcc1 T G 11: 120,287,385 S2257A probably damaging Het
Cd86 T C 16: 36,629,015 M7V possibly damaging Het
Cep57 A T 9: 13,810,761 S304R possibly damaging Het
Cep57l1 A T 10: 41,740,922 I123N possibly damaging Het
Cers6 A G 2: 68,861,664 N10S probably benign Het
Chrng A G 1: 87,211,352 D475G probably damaging Het
Crabp1 T A 9: 54,772,845 V128E probably damaging Het
Dcdc2a T C 13: 25,056,371 V34A possibly damaging Het
Fam102a G A 2: 32,560,090 V117I probably benign Het
Fbn1 A G 2: 125,466,612 C177R possibly damaging Het
Fras1 A G 5: 96,709,985 D2046G probably benign Het
Glul T C 1: 153,907,341 I220T probably benign Het
Gm10031 T C 1: 156,524,855 Y209H probably damaging Het
Gm10436 T A 12: 88,177,225 I273F possibly damaging Het
Gpc6 C T 14: 117,964,770 T464M probably damaging Het
Gpm6a T C 8: 55,058,798 S236P probably damaging Het
H2-K1 G T 17: 33,999,330 T204K probably benign Het
H2-K1 T C 17: 33,999,331 T204A probably benign Het
Hecw2 T C 1: 53,923,976 H792R possibly damaging Het
Herc4 T A 10: 63,275,042 I244K possibly damaging Het
Hsd11b2 G T 8: 105,523,334 R359L possibly damaging Het
Igsf9 G A 1: 172,484,889 E56K probably damaging Het
Il9 T C 13: 56,480,682 T65A possibly damaging Het
Kcnip1 T C 11: 33,642,478 T102A probably damaging Het
L3mbtl2 T C 15: 81,667,354 S74P probably benign Het
Lamc2 C T 1: 153,136,829 D700N probably benign Het
Ldb2 T C 5: 44,476,563 T322A possibly damaging Het
Lix1 A T 17: 17,443,750 I117F probably damaging Het
Map2 T A 1: 66,415,414 D1154E probably benign Het
Marco A T 1: 120,476,706 I425N probably damaging Het
Mark4 T C 7: 19,426,385 E650G probably benign Het
Mink1 A G 11: 70,611,720 T1086A possibly damaging Het
Nxf1 G A 19: 8,767,822 V479M probably damaging Het
Olfr138 A G 17: 38,275,259 T163A probably damaging Het
Olfr1420 T A 19: 11,896,024 M1K probably null Het
Olfr191 T C 16: 59,085,910 D191G probably damaging Het
Olfr191 A G 16: 59,086,429 V18A probably benign Het
Olfr744 T C 14: 50,618,701 F160L probably benign Het
Olfr774 T C 10: 129,238,460 S104P probably damaging Het
Otx2 T C 14: 48,658,758 D281G probably damaging Het
Pcdhga3 A T 18: 37,675,088 D198V probably damaging Het
Ppp1r13l T C 7: 19,370,575 V273A probably benign Het
Ppp6r2 T C 15: 89,253,252 probably null Het
Prg4 C T 1: 150,451,446 G873D probably damaging Het
Ptprq T C 10: 107,635,274 N1422S probably benign Het
Rbm27 A T 18: 42,327,505 K839M probably damaging Het
Rere A T 4: 150,468,798 N149I probably damaging Het
Ret A G 6: 118,179,319 L340S probably benign Het
Sel1l2 T A 2: 140,240,969 D583V possibly damaging Het
Shroom1 A T 11: 53,463,481 D76V possibly damaging Het
Slc5a3 C A 16: 92,079,075 S673R probably benign Het
Spink1 A T 18: 43,728,182 I74N probably damaging Het
Tbc1d1 T A 5: 64,278,009 S497T probably damaging Het
Trim3 C T 7: 105,611,071 R741Q probably damaging Het
Ttn A G 2: 76,916,678 C4676R probably benign Het
Ubqlnl G A 7: 104,148,752 P513S probably benign Het
Unc13d C T 11: 116,073,568 probably null Het
Vmn1r125 TGG TG 7: 21,272,219 probably null Het
Vmn2r7 A T 3: 64,725,015 C9S probably benign Het
Zcrb1 A G 15: 93,387,582 F173L probably benign Het
Zfp41 T C 15: 75,618,523 V108A probably damaging Het
Zfp438 T C 18: 5,213,209 E583G probably damaging Het
Zfp628 T C 7: 4,920,918 L713P probably damaging Het
Zfp664 T A 5: 124,885,978 C145* probably null Het
Zfp683 T C 4: 134,058,731 C390R probably damaging Het
Zfp941 G A 7: 140,812,097 P450S probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCATGAAGCCCACCTG -3'
(R):5'- TCCCTAGGAATAAGGTGAGGACTC -3'

Sequencing Primer
(F):5'- CCACCTGATGAAAGGAGAGTCATTC -3'
(R):5'- AGGACTCACAGCCTGGCATTTC -3'
Posted On2017-07-14