Mutagenetix > Incidental Mutations

Incidental Mutation 'R6059:Atp11b'

483108

Institutional Source

Beutler Lab

Gene Symbol

Atp11b

Ensembl Gene

ENSMUSG00000037400

Gene Name

ATPase, class VI, type 11B

Synonyms

1110019I14Rik

MMRRC Submission

044225-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R6059 (G1)

Quality Score

219.009

Status

Validated

Chromosome

Chromosomal Location

35754106-35856276 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35814177 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 466 (Y466C)

Ref Sequence

ENSEMBL: ENSMUSP00000142676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029257
AA Change: Y666C

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: Y666C

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	21	90	2.4e-24	PFAM
Pfam:E1-E2_ATPase	95	369	5.4e-13	PFAM
Pfam:Hydrolase	401	757	1.5e-10	PFAM
Pfam:HAD	404	829	5.9e-20	PFAM
Pfam:Cation_ATPase	492	605	7.1e-13	PFAM
Pfam:PhoLip_ATPase_C	846	1099	1.5e-76	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196700

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196965

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198599
AA Change: Y466C

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: Y466C

Domain	Start	End	E-Value	Type
low complexity region	90	107	N/A	INTRINSIC
Pfam:Hydrolase	201	632	3e-17	PFAM
Pfam:HAD	204	629	4e-16	PFAM
Pfam:Hydrolase_like2	292	405	1.2e-13	PFAM
low complexity region	833	848	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200445

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

95% (54/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	C	A	17: 48,090,327	T44K	probably benign	Het
4931406P16Rik	G	A	7: 34,245,463	A452V	possibly damaging	Het
Ablim2	A	G	5: 35,857,164	D189G	probably benign	Het
Abo	A	G	2: 26,843,353	V278A	possibly damaging	Het
Anxa1	A	G	19: 20,377,700	F237L	possibly damaging	Het
Cfh	T	A	1: 140,118,690	K531N	possibly damaging	Het
Cgref1	G	T	5: 30,945,384	P31Q	probably damaging	Het
Clca3a2	G	A	3: 144,810,770	A355V	probably damaging	Het
Cntnap5c	T	A	17: 58,313,712	C929S	probably damaging	Het
Col6a6	A	T	9: 105,783,917	V331D	probably damaging	Het
Cyp4a12b	T	A	4: 115,438,104	V469E	possibly damaging	Het
Dchs2	A	G	3: 83,355,736	S3104G	probably benign	Het
Ddx24	G	T	12: 103,408,300	A875E	probably damaging	Het
Dsc1	A	T	18: 20,110,242	N51K	probably damaging	Het
Epb41l3	A	G	17: 69,284,642	E708G	probably damaging	Het
Epb41l3	C	T	17: 69,286,798	T537I	probably damaging	Het
Fam162b	A	T	10: 51,590,307	C39S	probably benign	Het
Gbf1	T	C	19: 46,265,248	I531T	probably damaging	Het
Glipr1l2	T	C	10: 112,083,518	V48A	probably benign	Het
Gm11639	T	C	11: 105,036,769	I4788T	probably benign	Het
Gm13023	T	G	4: 143,793,980	S101A	possibly damaging	Het
Gorasp1	A	G	9: 119,930,006	V177A	probably damaging	Het
Gys1	A	G	7: 45,455,288		probably null	Het
Hif1a	T	A	12: 73,941,800	V523E	probably damaging	Het
Hnrnph3	A	T	10: 63,018,862		probably benign	Het
Lcn9	C	A	2: 25,824,725	L159I	possibly damaging	Het
Luzp1	C	T	4: 136,541,480	A338V	probably benign	Het
Map3k10	A	T	7: 27,656,822	S891T	probably damaging	Het
Mmrn2	C	T	14: 34,397,591	Q97*	probably null	Het
Mov10	G	A	3: 104,817,950		probably benign	Het
Ncam1	A	C	9: 49,544,666	Y551D	probably damaging	Het
Ncf1	A	T	5: 134,223,487	Y237N	probably damaging	Het
Nipbl	A	T	15: 8,295,568	I2537N	probably damaging	Het
Nlrp1b	A	T	11: 71,217,010	V555E	possibly damaging	Het
Nod2	T	C	8: 88,664,414	Y428H	probably damaging	Het
Nup133	C	A	8: 123,914,596	A862S	probably damaging	Het
Pcdhgb2	T	A	18: 37,690,025	L23*	probably null	Het
Pclo	A	G	5: 14,811,700	E4889G	unknown	Het
Plcd3	T	A	11: 103,080,401	I110F	possibly damaging	Het
Plxna2	C	A	1: 194,810,971	N1851K	possibly damaging	Het
Ppp2r5c	C	A	12: 110,574,788	A457E	probably benign	Het
Ppp5c	C	T	7: 17,027,907		probably benign	Het
Prg4	T	A	1: 150,449,997	Y1009F	possibly damaging	Het
Rcor3	A	T	1: 192,119,940	M303K	probably benign	Het
Rrn3	G	A	16: 13,806,604	M433I	probably benign	Het
Serpinb9e	G	A	13: 33,257,774	V230M	probably benign	Het
Shisa6	T	A	11: 66,224,974	H279L	probably damaging	Het
Slc38a11	A	T	2: 65,334,745	I234N	probably damaging	Het
Socs1	G	C	16: 10,784,530	F114L	probably damaging	Het
Ssc5d	C	T	7: 4,942,744	T925M	possibly damaging	Het
Stc1	T	C	14: 69,032,438	S156P	probably damaging	Het
Ttc5	C	G	14: 50,777,846	V103L	probably damaging	Het
Vmn1r73	A	G	7: 11,756,611	T119A	probably benign	Het
Vmn2r99	G	A	17: 19,378,980	D309N	probably benign	Het
Vps53	T	C	11: 76,066,867	H353R	possibly damaging	Het
Ythdf3	T	A	3: 16,203,192	Y47*	probably null	Het
Zfp276	T	C	8: 123,267,823	M543T	probably damaging	Het

Other mutations in Atp11b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp11b	APN	3	35809376	unclassified	probably null
IGL00722:Atp11b	APN	3	35819935	missense	probably damaging	1.00
IGL00725:Atp11b	APN	3	35827073	missense	probably damaging	0.97
IGL01514:Atp11b	APN	3	35836981	missense	probably damaging	1.00
IGL01532:Atp11b	APN	3	35849502	nonsense	probably null
IGL01789:Atp11b	APN	3	35789592	missense	possibly damaging	0.81
IGL01915:Atp11b	APN	3	35831463	missense	probably damaging	1.00
IGL02009:Atp11b	APN	3	35814152	missense	probably benign	0.07
IGL02049:Atp11b	APN	3	35800493	missense	probably damaging	0.99
IGL02952:Atp11b	APN	3	35828695	missense	probably damaging	1.00
IGL02991:Atp11b	UTSW	3	35826991	missense	probably benign	0.00
R0044:Atp11b	UTSW	3	35812252	missense	probably damaging	0.99
R0254:Atp11b	UTSW	3	35812110	missense	possibly damaging	0.82
R0538:Atp11b	UTSW	3	35837014	missense	probably damaging	1.00
R0541:Atp11b	UTSW	3	35806944	missense	probably damaging	0.99
R0653:Atp11b	UTSW	3	35839194	missense	probably damaging	0.99
R0790:Atp11b	UTSW	3	35832923	missense	probably damaging	1.00
R1083:Atp11b	UTSW	3	35778013	splice site	probably benign
R1371:Atp11b	UTSW	3	35806769	missense	probably damaging	0.97
R1458:Atp11b	UTSW	3	35789558	missense	probably damaging	1.00
R1875:Atp11b	UTSW	3	35839147	missense	probably damaging	1.00
R1921:Atp11b	UTSW	3	35834325	missense	probably damaging	1.00
R2008:Atp11b	UTSW	3	35855122	missense	probably damaging	0.97
R2065:Atp11b	UTSW	3	35839074	missense	probably damaging	1.00
R2112:Atp11b	UTSW	3	35837528	missense	probably damaging	1.00
R2228:Atp11b	UTSW	3	35806942	missense	probably damaging	1.00
R2270:Atp11b	UTSW	3	35810134	unclassified	probably null
R2273:Atp11b	UTSW	3	35828613	missense	probably benign	0.04
R2439:Atp11b	UTSW	3	35814084	missense	possibly damaging	0.68
R2497:Atp11b	UTSW	3	35855145	missense	probably damaging	0.99
R4181:Atp11b	UTSW	3	35789558	missense	probably damaging	1.00
R4181:Atp11b	UTSW	3	35800565	missense	probably benign	0.19
R4714:Atp11b	UTSW	3	35834394	missense	probably benign	0.02
R4923:Atp11b	UTSW	3	35835379	critical splice donor site	probably null
R4937:Atp11b	UTSW	3	35807008	unclassified	probably null
R5013:Atp11b	UTSW	3	35834383	missense	possibly damaging	0.66
R5058:Atp11b	UTSW	3	35809361	missense	probably benign	0.41
R5171:Atp11b	UTSW	3	35832937	missense	probably damaging	1.00
R5200:Atp11b	UTSW	3	35837007	missense	probably benign	0.21
R5465:Atp11b	UTSW	3	35810184	missense	probably benign	0.00
R5651:Atp11b	UTSW	3	35855140	missense	probably damaging	1.00
R5689:Atp11b	UTSW	3	35834352	missense	possibly damaging	0.67
R5718:Atp11b	UTSW	3	35837516	missense	probably benign	0.12
R5807:Atp11b	UTSW	3	35812279	missense	probably damaging	1.00
R5888:Atp11b	UTSW	3	35837547	missense	probably benign	0.15
R6259:Atp11b	UTSW	3	35806901	missense	probably damaging	1.00
R6359:Atp11b	UTSW	3	35778061	missense	probably benign	0.04
R6367:Atp11b	UTSW	3	35784537	missense	probably damaging	1.00
R6577:Atp11b	UTSW	3	35839162	missense	probably damaging	0.99
R6818:Atp11b	UTSW	3	35814180	missense	possibly damaging	0.71
R7016:Atp11b	UTSW	3	35841036	missense	probably benign
R7178:Atp11b	UTSW	3	35819950	missense	probably benign	0.34
R7614:Atp11b	UTSW	3	35810110	splice site	probably null
R7729:Atp11b	UTSW	3	35778107	missense	probably damaging	0.97
R7910:Atp11b	UTSW	3	35831503	missense	possibly damaging	0.68
R7991:Atp11b	UTSW	3	35831503	missense	possibly damaging	0.68
R8085:Atp11b	UTSW	3	35841036	missense	probably benign
R8095:Atp11b	UTSW	3	35834416	missense	probably damaging	1.00
Z1088:Atp11b	UTSW	3	35812213	missense	probably damaging	1.00
Z1177:Atp11b	UTSW	3	35806854	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TGAATCTGGCTCTTACAGAGGTG -3'
(R):5'- TGGCTCAGCAACTAAGTGCAC -3'

Sequencing Primer
(F):5'- GCTCTTACAGAGGTGTGTGTC -3'
(R):5'- ACTGAATGCTACTTCAGAGGTCCTG -3'

Posted On

2017-07-14