Incidental Mutation 'R6059:Ncf1'
ID483117
Institutional Source Beutler Lab
Gene Symbol Ncf1
Ensembl Gene ENSMUSG00000015950
Gene Nameneutrophil cytosolic factor 1
Synonymsp47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134220053-134229625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134223487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 237 (Y237N)
Ref Sequence ENSEMBL: ENSMUSP00000138121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000123941] [ENSMUST00000144086] [ENSMUST00000146354]
Predicted Effect probably damaging
Transcript: ENSMUST00000016094
AA Change: Y237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950
AA Change: Y237N

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111275
AA Change: Y237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950
AA Change: Y237N

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139249
Predicted Effect probably damaging
Transcript: ENSMUST00000144086
AA Change: Y237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950
AA Change: Y237N

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146354
AA Change: Y237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950
AA Change: Y237N

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182626
Meta Mutation Damage Score 0.8575 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Ncf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ncf1 APN 5 134226593 missense probably benign 0.03
IGL02718:Ncf1 APN 5 134227448 critical splice donor site probably null
R0143:Ncf1 UTSW 5 134227137 splice site probably benign
R0313:Ncf1 UTSW 5 134229567 start codon destroyed probably null 1.00
R0413:Ncf1 UTSW 5 134222802 splice site probably benign
R2037:Ncf1 UTSW 5 134229552 missense probably damaging 1.00
R2042:Ncf1 UTSW 5 134226640 missense probably benign 0.00
R2511:Ncf1 UTSW 5 134225698 missense probably damaging 0.99
R3545:Ncf1 UTSW 5 134226609 nonsense probably null
R3547:Ncf1 UTSW 5 134226609 nonsense probably null
R3548:Ncf1 UTSW 5 134226609 nonsense probably null
R4751:Ncf1 UTSW 5 134229545 missense probably damaging 1.00
R4989:Ncf1 UTSW 5 134223413 missense probably damaging 0.98
R5288:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5384:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5385:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5590:Ncf1 UTSW 5 134223501 missense probably damaging 0.98
R6136:Ncf1 UTSW 5 134226633 missense probably damaging 1.00
R7023:Ncf1 UTSW 5 134225262 missense possibly damaging 0.48
R7310:Ncf1 UTSW 5 134221761 missense probably benign 0.04
R7618:Ncf1 UTSW 5 134227267 missense probably benign 0.08
R7838:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
R7921:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAGTCAGCTCAGAGCCCAAG -3'
(R):5'- CAGCGTGCATGCACACATAC -3'

Sequencing Primer
(F):5'- CTCAGAGCCCAAGAGAGGTTC -3'
(R):5'- TGGTAGAGCCCTTGCCTAGAATC -3'
Posted On2017-07-14