Incidental Mutation 'R6059:4931406P16Rik'
ID483122
Institutional Source Beutler Lab
Gene Symbol 4931406P16Rik
Ensembl Gene ENSMUSG00000066571
Gene NameRIKEN cDNA 4931406P16 gene
Synonyms
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location34236707-34313551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34245463 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 452 (A452V)
Ref Sequence ENSEMBL: ENSMUSP00000145762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
Predicted Effect probably benign
Transcript: ENSMUST00000085592
AA Change: A664V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: A664V

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108074
AA Change: A664V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: A664V

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect possibly damaging
Transcript: ENSMUST00000206399
AA Change: A452V

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207005
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in 4931406P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:4931406P16Rik APN 7 34245987 splice site probably benign
IGL00160:4931406P16Rik APN 7 34239006 missense possibly damaging 0.88
IGL00691:4931406P16Rik APN 7 34245485 missense probably damaging 1.00
IGL01312:4931406P16Rik APN 7 34256508 missense probably benign 0.19
IGL01954:4931406P16Rik APN 7 34245035 missense probably damaging 1.00
IGL02016:4931406P16Rik APN 7 34239101 missense possibly damaging 0.74
IGL02390:4931406P16Rik APN 7 34248218 missense probably damaging 1.00
IGL02407:4931406P16Rik APN 7 34256484 missense probably damaging 0.99
IGL02677:4931406P16Rik APN 7 34242409 splice site probably benign
IGL02929:4931406P16Rik APN 7 34245082 missense possibly damaging 0.46
IGL03285:4931406P16Rik APN 7 34284991 missense possibly damaging 0.81
I1329:4931406P16Rik UTSW 7 34245194 missense probably benign 0.00
R0004:4931406P16Rik UTSW 7 34256428 missense probably damaging 0.99
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0135:4931406P16Rik UTSW 7 34245957 missense probably damaging 1.00
R0137:4931406P16Rik UTSW 7 34239219 missense probably damaging 1.00
R0556:4931406P16Rik UTSW 7 34239797 missense probably damaging 0.99
R0687:4931406P16Rik UTSW 7 34245418 missense possibly damaging 0.95
R0928:4931406P16Rik UTSW 7 34248246 splice site probably null
R1719:4931406P16Rik UTSW 7 34248206 missense probably damaging 0.98
R1908:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1909:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1976:4931406P16Rik UTSW 7 34257380 missense probably damaging 0.99
R2496:4931406P16Rik UTSW 7 34256491 missense possibly damaging 0.93
R3005:4931406P16Rik UTSW 7 34284784 missense probably damaging 1.00
R4666:4931406P16Rik UTSW 7 34284773 missense probably damaging 0.98
R4832:4931406P16Rik UTSW 7 34238908 utr 3 prime probably benign
R4870:4931406P16Rik UTSW 7 34284887 missense possibly damaging 0.83
R4989:4931406P16Rik UTSW 7 34245800 missense probably damaging 1.00
R5033:4931406P16Rik UTSW 7 34245812 missense probably benign
R5308:4931406P16Rik UTSW 7 34245755 nonsense probably null
R5366:4931406P16Rik UTSW 7 34242288 missense possibly damaging 0.74
R5386:4931406P16Rik UTSW 7 34242388 missense probably damaging 0.99
R5688:4931406P16Rik UTSW 7 34253991 missense possibly damaging 0.74
R5688:4931406P16Rik UTSW 7 34284709 missense probably damaging 0.99
R5714:4931406P16Rik UTSW 7 34240516 nonsense probably null
R5733:4931406P16Rik UTSW 7 34245080 missense probably damaging 0.99
R5772:4931406P16Rik UTSW 7 34253988 missense probably damaging 0.97
R6211:4931406P16Rik UTSW 7 34239004 missense possibly damaging 0.95
R6276:4931406P16Rik UTSW 7 34242377 nonsense probably null
R6477:4931406P16Rik UTSW 7 34257630 critical splice donor site probably null
R6757:4931406P16Rik UTSW 7 34239077 missense possibly damaging 0.89
R6912:4931406P16Rik UTSW 7 34245668 missense probably benign
R7156:4931406P16Rik UTSW 7 34245708 missense possibly damaging 0.80
R7317:4931406P16Rik UTSW 7 34263647 missense probably benign
R7431:4931406P16Rik UTSW 7 34284794 missense possibly damaging 0.73
R7452:4931406P16Rik UTSW 7 34245671 missense probably benign
R7996:4931406P16Rik UTSW 7 34263599 missense possibly damaging 0.77
RF019:4931406P16Rik UTSW 7 34240549 missense probably damaging 0.98
X0021:4931406P16Rik UTSW 7 34245363 missense possibly damaging 0.94
Z1177:4931406P16Rik UTSW 7 34284755 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTGCTGTGATCCAATGGG -3'
(R):5'- CAATGGTCAATGGCTTTCTCC -3'

Sequencing Primer
(F):5'- TCCAATGGGTTGCAGCAG -3'
(R):5'- CTCCTGGAGAGACGTGAGAACTTC -3'
Posted On2017-07-14