Incidental Mutation 'R6059:Nup133'
ID483127
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123914596 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 862 (A862S)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044795
AA Change: A862S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: A862S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213089
Meta Mutation Damage Score 0.7298 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8703:Nup133 UTSW 8 123916282 critical splice donor site probably null
R8811:Nup133 UTSW 8 123911888 frame shift probably null
R8813:Nup133 UTSW 8 123911888 frame shift probably null
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAATCTGTCATGTTCCCCTC -3'
(R):5'- AGATCAGGAAGGTTTGTTCTGC -3'

Sequencing Primer
(F):5'- ACAGCAGCTTTCTGGACAG -3'
(R):5'- CTAGTGAGTAGTGGGAGTCTCCTC -3'
Posted On2017-07-14