Incidental Mutation 'R6059:Plcd3'
ID483137
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Namephospholipase C, delta 3
Synonyms2610205J15Rik
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R6059 (G1)
Quality Score191.009
Status Validated
Chromosome11
Chromosomal Location103070304-103101658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103080401 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 110 (I110F)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103077
AA Change: I110F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: I110F

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128650
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.1761 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 103077870 missense probably benign 0.16
IGL01906:Plcd3 APN 11 103076856 missense probably damaging 1.00
IGL02325:Plcd3 APN 11 103080621 nonsense probably null
IGL02634:Plcd3 APN 11 103077827 missense probably damaging 1.00
IGL02852:Plcd3 APN 11 103073805 missense probably damaging 1.00
IGL03025:Plcd3 APN 11 103074898 missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 103071103 missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 103076742 missense probably benign
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0062:Plcd3 UTSW 11 103074894 missense probably benign
R0452:Plcd3 UTSW 11 103071259 unclassified probably benign
R0529:Plcd3 UTSW 11 103080187 missense probably benign 0.00
R0556:Plcd3 UTSW 11 103077806 missense probably damaging 1.00
R1463:Plcd3 UTSW 11 103078373 missense probably damaging 1.00
R1752:Plcd3 UTSW 11 103080259 missense probably benign 0.01
R2157:Plcd3 UTSW 11 103071148 missense probably benign
R2519:Plcd3 UTSW 11 103080400 missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 103101383 missense probably null 0.03
R4167:Plcd3 UTSW 11 103078464 missense probably damaging 0.98
R5100:Plcd3 UTSW 11 103078349 missense probably benign
R5387:Plcd3 UTSW 11 103078455 missense probably damaging 1.00
R5589:Plcd3 UTSW 11 103077803 missense probably benign 0.01
R5700:Plcd3 UTSW 11 103073763 missense probably benign 0.00
R5754:Plcd3 UTSW 11 103073766 missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 103078347 missense probably damaging 1.00
R6102:Plcd3 UTSW 11 103080644 missense probably damaging 0.99
R6480:Plcd3 UTSW 11 103074931 missense possibly damaging 0.79
R6481:Plcd3 UTSW 11 103077767 missense probably damaging 1.00
R6566:Plcd3 UTSW 11 103073800 missense probably damaging 1.00
R7098:Plcd3 UTSW 11 103077863 missense probably damaging 1.00
R7165:Plcd3 UTSW 11 103079613 missense probably damaging 1.00
R7392:Plcd3 UTSW 11 103101557 unclassified probably benign
R7484:Plcd3 UTSW 11 103071719 missense probably damaging 1.00
R7606:Plcd3 UTSW 11 103076857 missense probably damaging 1.00
R7777:Plcd3 UTSW 11 103074655 missense probably benign 0.33
R7857:Plcd3 UTSW 11 103077934 missense probably benign 0.12
R7940:Plcd3 UTSW 11 103077934 missense probably benign 0.12
X0023:Plcd3 UTSW 11 103080208 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATATTGGTCTAGGCGCTCC -3'
(R):5'- AGGATGTCCAAGCCATGCTG -3'

Sequencing Primer
(F):5'- TGGCTCATGGCATCCAGG -3'
(R):5'- ACAAGGAGCGGCTGTACC -3'
Posted On2017-07-14