Mutagenetix > Incidental Mutation

Incidental Mutation 'R6059:Rrn3'

483148

Institutional Source

Beutler Lab

Gene Symbol

Rrn3

Ensembl Gene

ENSMUSG00000022682

Gene Name

RRN3 RNA polymerase I transcription factor homolog (yeast)

Synonyms

TIF-1A, E130302O19Rik

MMRRC Submission

044225-MU

Accession Numbers

Genbank: NM_001039521; MGI: 1925255

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6059 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13780708-13814839 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13806604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 433 (M433I)

Ref Sequence

ENSEMBL: ENSMUSP00000023363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023363]

AlphaFold

B2RS91

Predicted Effect

probably benign
Transcript: ENSMUST00000023363
AA Change: M433I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023363
Gene: ENSMUSG00000022682
AA Change: M433I

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:RRN3	46	584	7.5e-138	PFAM
low complexity region	597	605	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

95% (54/57)

MGI Phenotype

PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure to undergo embryonic turning, delayed embryonic development, markedly reduced embryo size, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(38) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(36)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	C	A	17: 48,090,327	T44K	probably benign	Het
4931406P16Rik	G	A	7: 34,245,463	A452V	possibly damaging	Het
Ablim2	A	G	5: 35,857,164	D189G	probably benign	Het
Abo	A	G	2: 26,843,353	V278A	possibly damaging	Het
Anxa1	A	G	19: 20,377,700	F237L	possibly damaging	Het
Atp11b	A	G	3: 35,814,177	Y466C	possibly damaging	Het
Cfh	T	A	1: 140,118,690	K531N	possibly damaging	Het
Cgref1	G	T	5: 30,945,384	P31Q	probably damaging	Het
Clca3a2	G	A	3: 144,810,770	A355V	probably damaging	Het
Cntnap5c	T	A	17: 58,313,712	C929S	probably damaging	Het
Col6a6	A	T	9: 105,783,917	V331D	probably damaging	Het
Cyp4a12b	T	A	4: 115,438,104	V469E	possibly damaging	Het
Dchs2	A	G	3: 83,355,736	S3104G	probably benign	Het
Ddx24	G	T	12: 103,408,300	A875E	probably damaging	Het
Dsc1	A	T	18: 20,110,242	N51K	probably damaging	Het
Epb41l3	A	G	17: 69,284,642	E708G	probably damaging	Het
Epb41l3	C	T	17: 69,286,798	T537I	probably damaging	Het
Fam162b	A	T	10: 51,590,307	C39S	probably benign	Het
Gbf1	T	C	19: 46,265,248	I531T	probably damaging	Het
Glipr1l2	T	C	10: 112,083,518	V48A	probably benign	Het
Gm11639	T	C	11: 105,036,769	I4788T	probably benign	Het
Gm13023	T	G	4: 143,793,980	S101A	possibly damaging	Het
Gorasp1	A	G	9: 119,930,006	V177A	probably damaging	Het
Gys1	A	G	7: 45,455,288		probably null	Het
Hif1a	T	A	12: 73,941,800	V523E	probably damaging	Het
Hnrnph3	A	T	10: 63,018,862		probably benign	Het
Lcn9	C	A	2: 25,824,725	L159I	possibly damaging	Het
Luzp1	C	T	4: 136,541,480	A338V	probably benign	Het
Map3k10	A	T	7: 27,656,822	S891T	probably damaging	Het
Mmrn2	C	T	14: 34,397,591	Q97*	probably null	Het
Mov10	G	A	3: 104,817,950		probably benign	Het
Ncam1	A	C	9: 49,544,666	Y551D	probably damaging	Het
Ncf1	A	T	5: 134,223,487	Y237N	probably damaging	Het
Nipbl	A	T	15: 8,295,568	I2537N	probably damaging	Het
Nlrp1b	A	T	11: 71,217,010	V555E	possibly damaging	Het
Nod2	T	C	8: 88,664,414	Y428H	probably damaging	Het
Nup133	C	A	8: 123,914,596	A862S	probably damaging	Het
Pcdhgb2	T	A	18: 37,690,025	L23*	probably null	Het
Pclo	A	G	5: 14,811,700	E4889G	unknown	Het
Plcd3	T	A	11: 103,080,401	I110F	possibly damaging	Het
Plxna2	C	A	1: 194,810,971	N1851K	possibly damaging	Het
Ppp2r5c	C	A	12: 110,574,788	A457E	probably benign	Het
Ppp5c	C	T	7: 17,027,907		probably benign	Het
Prg4	T	A	1: 150,449,997	Y1009F	possibly damaging	Het
Rcor3	A	T	1: 192,119,940	M303K	probably benign	Het
Serpinb9e	G	A	13: 33,257,774	V230M	probably benign	Het
Shisa6	T	A	11: 66,224,974	H279L	probably damaging	Het
Slc38a11	A	T	2: 65,334,745	I234N	probably damaging	Het
Socs1	G	C	16: 10,784,530	F114L	probably damaging	Het
Ssc5d	C	T	7: 4,942,744	T925M	possibly damaging	Het
Stc1	T	C	14: 69,032,438	S156P	probably damaging	Het
Ttc5	C	G	14: 50,777,846	V103L	probably damaging	Het
Vmn1r73	A	G	7: 11,756,611	T119A	probably benign	Het
Vmn2r99	G	A	17: 19,378,980	D309N	probably benign	Het
Vps53	T	C	11: 76,066,867	H353R	possibly damaging	Het
Ythdf3	T	A	3: 16,203,192	Y47*	probably null	Het
Zfp276	T	C	8: 123,267,823	M543T	probably damaging	Het

Other mutations in Rrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Rrn3	APN	16	13809062	missense	probably damaging	1.00
IGL02507:Rrn3	APN	16	13788857	missense	probably benign
IGL02607:Rrn3	APN	16	13806563	missense	possibly damaging	0.65
IGL02648:Rrn3	APN	16	13811589	missense	probably benign
IGL03217:Rrn3	APN	16	13809011	missense	possibly damaging	0.83
IGL03403:Rrn3	APN	16	13799945	nonsense	probably null
11287:Rrn3	UTSW	16	13800019	splice site	probably null
ANU74:Rrn3	UTSW	16	13811533	missense	possibly damaging	0.65
R0013:Rrn3	UTSW	16	13813113	missense	possibly damaging	0.92
R0013:Rrn3	UTSW	16	13813113	missense	possibly damaging	0.92
R0308:Rrn3	UTSW	16	13799882	splice site	probably benign
R1970:Rrn3	UTSW	16	13789074	missense	probably damaging	1.00
R3712:Rrn3	UTSW	16	13784095	nonsense	probably null
R3959:Rrn3	UTSW	16	13782100	critical splice donor site	probably null
R4343:Rrn3	UTSW	16	13784122	missense	probably benign	0.01
R4678:Rrn3	UTSW	16	13796076	missense	probably damaging	1.00
R4920:Rrn3	UTSW	16	13790639	missense	probably benign	0.01
R4925:Rrn3	UTSW	16	13799972	missense	probably damaging	1.00
R5225:Rrn3	UTSW	16	13792934	splice site	probably null
R5469:Rrn3	UTSW	16	13813100	missense	probably benign	0.01
R5702:Rrn3	UTSW	16	13813266	nonsense	probably null
R6425:Rrn3	UTSW	16	13811601	missense	probably benign	0.00
R7582:Rrn3	UTSW	16	13810511	nonsense	probably null
R7814:Rrn3	UTSW	16	13811589	missense	probably benign
R8332:Rrn3	UTSW	16	13798620	missense	possibly damaging	0.61
R9315:Rrn3	UTSW	16	13788826	missense	probably benign	0.00
R9752:Rrn3	UTSW	16	13813231	missense	probably benign
R9757:Rrn3	UTSW	16	13810569	missense	probably damaging	0.96
Z1176:Rrn3	UTSW	16	13813156	missense	probably damaging	1.00
Z1177:Rrn3	UTSW	16	13788846	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCTCTGCTAGTGGGTAAGGG -3'
(R):5'- CAGTAGCAGTGCCCTAAAGGTA -3'

Sequencing Primer
(F):5'- CATGCATGTTAAGCAGTTGCC -3'
(R):5'- TAGCAGTGCCCTAAAGGTATAAGTAC -3'

Posted On

2017-07-14