Incidental Mutation 'R6059:Dsc1'
ID483154
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20110242 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 51 (N51K)
Ref Sequence ENSEMBL: ENSMUSP00000042303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432] [ENSMUST00000226115]
Predicted Effect probably damaging
Transcript: ENSMUST00000038710
AA Change: N51K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: N51K

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224432
AA Change: N51K

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Predicted Effect probably damaging
Transcript: ENSMUST00000226115
AA Change: N51K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1726 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Lcn9 C A 2: 25,824,725 L159I possibly damaging Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCATGAAAGTACATCC -3'
(R):5'- GGAACCATAACTTCACTAGTTTAGC -3'

Sequencing Primer
(F):5'- TGCTGACAGTACAACTTCTAGC -3'
(R):5'- AGCTTTCACGATCCCTACATTTAG -3'
Posted On2017-07-14