Incidental Mutation 'R6060:Trmt1l'
ID 483162
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene Name tRNA methyltransferase 1 like
Synonyms 1190005F20Rik, Trm1-like
MMRRC Submission 044426-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6060 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 151304293-151333912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 151333331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 642 (N642S)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000065625
AA Change: N642S

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: N642S

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 88,966,630 (GRCm39) probably null Het
Adh1 T C 3: 137,992,544 (GRCm39) I220T probably damaging Het
Ajap1 G A 4: 153,516,699 (GRCm39) T214I probably damaging Het
Ank2 A G 3: 126,749,601 (GRCm39) F476S probably damaging Het
Atp6v1g3 A G 1: 138,201,582 (GRCm39) K27E possibly damaging Het
BC034090 A G 1: 155,117,245 (GRCm39) I291T probably benign Het
Cnot9 T A 1: 74,556,285 (GRCm39) N27K probably benign Het
Cyp2c70 A T 19: 40,153,857 (GRCm39) L244* probably null Het
Cyp2d22 T C 15: 82,260,086 (GRCm39) T6A probably benign Het
D630045J12Rik T C 6: 38,107,799 (GRCm39) E1829G probably damaging Het
Dnajc4 G T 19: 6,968,093 (GRCm39) S61* probably null Het
Dpysl4 A G 7: 138,669,324 (GRCm39) M1V probably null Het
Fam149a T A 8: 45,811,799 (GRCm39) probably benign Het
Fam184b T C 5: 45,710,489 (GRCm39) E547G probably damaging Het
Fam47e T A 5: 92,727,472 (GRCm39) F127I possibly damaging Het
Ifi207 G A 1: 173,558,093 (GRCm39) T215I unknown Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Lpxn T C 19: 12,810,489 (GRCm39) L311P probably damaging Het
Lrp1b A T 2: 40,640,946 (GRCm39) N3499K Het
Mknk2 A T 10: 80,507,468 (GRCm39) D76E probably benign Het
Nectin2 A T 7: 19,451,700 (GRCm39) Y445N probably damaging Het
Ngb A C 12: 87,146,963 (GRCm39) S85A probably benign Het
Nrp1 C A 8: 129,224,419 (GRCm39) H727Q probably damaging Het
Or5b112 C T 19: 13,319,497 (GRCm39) A125V probably benign Het
Or6k2 C A 1: 173,986,907 (GRCm39) C189* probably null Het
Pold3 A C 7: 99,749,819 (GRCm39) Y115* probably null Het
Ppp1r12b C G 1: 134,883,262 (GRCm39) V87L probably benign Het
Ppp1r26 A G 2: 28,341,042 (GRCm39) N224S probably benign Het
Prl7a1 G A 13: 27,821,571 (GRCm39) P122S probably damaging Het
Rc3h2 T C 2: 37,289,612 (GRCm39) H400R possibly damaging Het
Rnf32 A T 5: 29,411,752 (GRCm39) I214L probably benign Het
Safb2 A T 17: 56,870,246 (GRCm39) probably null Het
Serpinb6e A G 13: 34,025,256 (GRCm39) C12R possibly damaging Het
Sh2b2 A T 5: 136,261,209 (GRCm39) N2K possibly damaging Het
Slc12a4 G A 8: 106,672,338 (GRCm39) A821V probably damaging Het
Slc41a1 A G 1: 131,767,972 (GRCm39) M179V probably benign Het
Slc9a3 A G 13: 74,299,004 (GRCm39) Y141C probably damaging Het
Tenm4 G A 7: 96,522,918 (GRCm39) V1450I probably damaging Het
Ttll13 G A 7: 79,908,491 (GRCm39) R576H probably damaging Het
Zar1 T A 5: 72,738,272 (GRCm39) R43S probably benign Het
Zfp455 A G 13: 67,355,257 (GRCm39) Y175C probably damaging Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151,318,463 (GRCm39) critical splice donor site probably null
IGL02175:Trmt1l APN 1 151,324,235 (GRCm39) missense probably benign 0.00
IGL02348:Trmt1l APN 1 151,325,757 (GRCm39) missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151,315,282 (GRCm39) missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151,309,536 (GRCm39) splice site probably benign
IGL03150:Trmt1l APN 1 151,329,643 (GRCm39) missense probably benign 0.00
IGL03220:Trmt1l APN 1 151,316,692 (GRCm39) splice site probably benign
Canyonlands UTSW 1 151,329,799 (GRCm39) nonsense probably null
splendiforous UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
IGL03014:Trmt1l UTSW 1 151,333,681 (GRCm39) missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0067:Trmt1l UTSW 1 151,324,131 (GRCm39) missense probably benign 0.16
R0240:Trmt1l UTSW 1 151,333,205 (GRCm39) unclassified probably benign
R0267:Trmt1l UTSW 1 151,333,426 (GRCm39) unclassified probably benign
R2084:Trmt1l UTSW 1 151,316,605 (GRCm39) missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151,311,594 (GRCm39) critical splice donor site probably null
R2338:Trmt1l UTSW 1 151,304,710 (GRCm39) intron probably benign
R2408:Trmt1l UTSW 1 151,315,267 (GRCm39) missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151,309,581 (GRCm39) missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151,329,696 (GRCm39) missense probably benign 0.14
R3972:Trmt1l UTSW 1 151,309,634 (GRCm39) missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151,330,784 (GRCm39) missense probably benign 0.18
R4361:Trmt1l UTSW 1 151,311,626 (GRCm39) intron probably benign
R4411:Trmt1l UTSW 1 151,327,905 (GRCm39) missense probably benign 0.02
R4419:Trmt1l UTSW 1 151,316,559 (GRCm39) missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151,324,094 (GRCm39) nonsense probably null
R4614:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4617:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4618:Trmt1l UTSW 1 151,329,799 (GRCm39) nonsense probably null
R4647:Trmt1l UTSW 1 151,333,632 (GRCm39) missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151,315,320 (GRCm39) missense probably benign 0.00
R4734:Trmt1l UTSW 1 151,318,388 (GRCm39) missense probably benign 0.32
R4873:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R4875:Trmt1l UTSW 1 151,330,755 (GRCm39) missense probably benign 0.04
R5026:Trmt1l UTSW 1 151,316,627 (GRCm39) missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151,330,746 (GRCm39) missense probably benign
R5587:Trmt1l UTSW 1 151,311,455 (GRCm39) intron probably benign
R5872:Trmt1l UTSW 1 151,316,594 (GRCm39) missense probably damaging 1.00
R6169:Trmt1l UTSW 1 151,304,704 (GRCm39) intron probably benign
R6333:Trmt1l UTSW 1 151,329,685 (GRCm39) missense probably benign 0.15
R6906:Trmt1l UTSW 1 151,327,926 (GRCm39) missense probably benign 0.03
R7269:Trmt1l UTSW 1 151,333,539 (GRCm39) missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151,316,591 (GRCm39) missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151,316,639 (GRCm39) missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151,318,425 (GRCm39) missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151,311,489 (GRCm39) missense probably benign 0.02
R8257:Trmt1l UTSW 1 151,304,629 (GRCm39) start codon destroyed probably null
R8286:Trmt1l UTSW 1 151,333,543 (GRCm39) missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151,325,727 (GRCm39) missense probably benign 0.10
R8451:Trmt1l UTSW 1 151,324,039 (GRCm39) missense unknown
R8514:Trmt1l UTSW 1 151,329,742 (GRCm39) missense probably damaging 0.98
R9287:Trmt1l UTSW 1 151,328,899 (GRCm39) missense probably damaging 1.00
R9423:Trmt1l UTSW 1 151,325,817 (GRCm39) missense possibly damaging 0.90
R9622:Trmt1l UTSW 1 151,304,710 (GRCm39) nonsense probably null
X0039:Trmt1l UTSW 1 151,330,741 (GRCm39) missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151,328,864 (GRCm39) missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151,333,331 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAGTGAGAATTGTGTAGTCGACAG -3'
(R):5'- AACTGCATCAGAGGGGCATC -3'

Sequencing Primer
(F):5'- TGTGTAGTCGACAGGATTATAAAAGC -3'
(R):5'- TACGGATGCCCATTGGGTC -3'
Posted On 2017-07-14