Mutagenetix > Incidental Mutation

Incidental Mutation 'R6060:Trmt1l'

483162

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6060 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 151457580 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 642 (N642S)

Ref Sequence

ENSEMBL: ENSMUSP00000068309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065625
AA Change: N642S

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: N642S

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000189655

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190070

SMART Domains

Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

Domain	Start	End	E-Value	Type
Blast:RING	1	35	7e-16	BLAST
PDB:3H8H\|A	73	156	2e-56	PDB

Meta Mutation Damage Score

0.1335

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110057P08Rik	A	G	16: 89,169,742		probably null	Het
Adh1	T	C	3: 138,286,783	I220T	probably damaging	Het
Ajap1	G	A	4: 153,432,242	T214I	probably damaging	Het
Ank2	A	G	3: 126,955,952	F476S	probably damaging	Het
Atp6v1g3	A	G	1: 138,273,844	K27E	possibly damaging	Het
B230118H07Rik	T	C	2: 101,610,605	K18E	probably benign	Het
BC034090	A	G	1: 155,241,499	I291T	probably benign	Het
Cnot9	T	A	1: 74,517,126	N27K	probably benign	Het
Cyp2c70	A	T	19: 40,165,413	L244*	probably null	Het
Cyp2d22	T	C	15: 82,375,885	T6A	probably benign	Het
D630045J12Rik	T	C	6: 38,130,864	E1829G	probably damaging	Het
Dnajc4	G	T	19: 6,990,725	S61*	probably null	Het
Dpysl4	A	G	7: 139,089,408	M1V	probably null	Het
Fam149a	T	A	8: 45,358,762		probably benign	Het
Fam184b	T	C	5: 45,553,147	E547G	probably damaging	Het
Fam47e	T	A	5: 92,579,613	F127I	possibly damaging	Het
Ifi207	G	A	1: 173,730,527	T215I	unknown	Het
Lpxn	T	C	19: 12,833,125	L311P	probably damaging	Het
Lrp1b	A	T	2: 40,750,934	N3499K		Het
Mknk2	A	T	10: 80,671,634	D76E	probably benign	Het
Nectin2	A	T	7: 19,717,775	Y445N	probably damaging	Het
Ngb	A	C	12: 87,100,189	S85A	probably benign	Het
Nrp1	C	A	8: 128,497,938	H727Q	probably damaging	Het
Olfr1466	C	T	19: 13,342,133	A125V	probably benign	Het
Olfr420	C	A	1: 174,159,341	C189*	probably null	Het
Pold3	A	C	7: 100,100,612	Y115*	probably null	Het
Ppp1r12b	C	G	1: 134,955,524	V87L	probably benign	Het
Ppp1r26	A	G	2: 28,451,030	N224S	probably benign	Het
Prl7a1	G	A	13: 27,637,588	P122S	probably damaging	Het
Rc3h2	T	C	2: 37,399,600	H400R	possibly damaging	Het
Rnf32	A	T	5: 29,206,754	I214L	probably benign	Het
Safb2	A	T	17: 56,563,246		probably null	Het
Serpinb6e	A	G	13: 33,841,273	C12R	possibly damaging	Het
Sh2b2	A	T	5: 136,232,355	N2K	possibly damaging	Het
Slc12a4	G	A	8: 105,945,706	A821V	probably damaging	Het
Slc41a1	A	G	1: 131,840,234	M179V	probably benign	Het
Slc9a3	A	G	13: 74,150,885	Y141C	probably damaging	Het
Tenm4	G	A	7: 96,873,711	V1450I	probably damaging	Het
Ttll13	G	A	7: 80,258,743	R576H	probably damaging	Het
Zar1	T	A	5: 72,580,929	R43S	probably benign	Het
Zfp455	A	G	13: 67,207,193	Y175C	probably damaging	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2338:Trmt1l	UTSW	1	151428959	intron	probably benign
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CAGTGAGAATTGTGTAGTCGACAG -3'
(R):5'- AACTGCATCAGAGGGGCATC -3'

Sequencing Primer
(F):5'- TGTGTAGTCGACAGGATTATAAAAGC -3'
(R):5'- TACGGATGCCCATTGGGTC -3'

Posted On

2017-07-14