Incidental Mutation 'R6060:Fam184b'
ID 483181
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Name family with sequence similarity 184, member B
Synonyms 9630031F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6060 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 45529705-45639614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45553147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 547 (E547G)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
AlphaFold Q0KK56
Predicted Effect probably damaging
Transcript: ENSMUST00000016023
AA Change: E547G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: E547G

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199642
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
R9470:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R9649:Fam184b UTSW 5 45639142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGAAACCAGTCCTTCATG -3'
(R):5'- AGCACTGACTAAGATCAGTAGAAC -3'

Sequencing Primer
(F):5'- GATGGAAACCAGTCCTTCATGTTTTC -3'
(R):5'- CTTACAACTTAAGGCAGGTTGC -3'
Posted On 2017-07-14