Incidental Mutation 'R6060:Sh2b2'
ID483184
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene NameSH2B adaptor protein 2
SynonymsAps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R6060 (G1)
Quality Score182.009
Status Validated
Chromosome5
Chromosomal Location136218147-136246556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136232355 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000142728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005188
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196245
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000196397
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196447
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
BB002:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
BB012:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R0492:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R5486:Sh2b2 UTSW 5 136232090 missense probably benign 0.10
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7020:Sh2b2 UTSW 5 136224299 missense possibly damaging 0.69
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
R7925:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R8244:Sh2b2 UTSW 5 136227437 nonsense probably null
R8291:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R8786:Sh2b2 UTSW 5 136231804 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGTTGGCTGCAAAGTGGC -3'
(R):5'- CCAGAGGATTCAAAGTCGTTTTAAC -3'

Sequencing Primer
(F):5'- TGGCGGGAGAATGAGGTCC -3'
(R):5'- TTGGCATCCTAGCACATGAG -3'
Posted On2017-07-14