Mutagenetix > Incidental Mutation

Incidental Mutation 'R6060:Slc9a3'

483204

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

044426-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6060 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74150885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 141 (Y141C)

Ref Sequence

ENSEMBL: ENSMUSP00000153255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: Y141C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225423
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110057P08Rik	A	G	16: 89,169,742		probably null	Het
Adh1	T	C	3: 138,286,783	I220T	probably damaging	Het
Ajap1	G	A	4: 153,432,242	T214I	probably damaging	Het
Ank2	A	G	3: 126,955,952	F476S	probably damaging	Het
Atp6v1g3	A	G	1: 138,273,844	K27E	possibly damaging	Het
B230118H07Rik	T	C	2: 101,610,605	K18E	probably benign	Het
BC034090	A	G	1: 155,241,499	I291T	probably benign	Het
Cnot9	T	A	1: 74,517,126	N27K	probably benign	Het
Cyp2c70	A	T	19: 40,165,413	L244*	probably null	Het
Cyp2d22	T	C	15: 82,375,885	T6A	probably benign	Het
D630045J12Rik	T	C	6: 38,130,864	E1829G	probably damaging	Het
Dnajc4	G	T	19: 6,990,725	S61*	probably null	Het
Dpysl4	A	G	7: 139,089,408	M1V	probably null	Het
Fam149a	T	A	8: 45,358,762		probably benign	Het
Fam184b	T	C	5: 45,553,147	E547G	probably damaging	Het
Fam47e	T	A	5: 92,579,613	F127I	possibly damaging	Het
Ifi207	G	A	1: 173,730,527	T215I	unknown	Het
Lpxn	T	C	19: 12,833,125	L311P	probably damaging	Het
Lrp1b	A	T	2: 40,750,934	N3499K		Het
Mknk2	A	T	10: 80,671,634	D76E	probably benign	Het
Nectin2	A	T	7: 19,717,775	Y445N	probably damaging	Het
Ngb	A	C	12: 87,100,189	S85A	probably benign	Het
Nrp1	C	A	8: 128,497,938	H727Q	probably damaging	Het
Olfr1466	C	T	19: 13,342,133	A125V	probably benign	Het
Olfr420	C	A	1: 174,159,341	C189*	probably null	Het
Pold3	A	C	7: 100,100,612	Y115*	probably null	Het
Ppp1r12b	C	G	1: 134,955,524	V87L	probably benign	Het
Ppp1r26	A	G	2: 28,451,030	N224S	probably benign	Het
Prl7a1	G	A	13: 27,637,588	P122S	probably damaging	Het
Rc3h2	T	C	2: 37,399,600	H400R	possibly damaging	Het
Rnf32	A	T	5: 29,206,754	I214L	probably benign	Het
Safb2	A	T	17: 56,563,246		probably null	Het
Serpinb6e	A	G	13: 33,841,273	C12R	possibly damaging	Het
Sh2b2	A	T	5: 136,232,355	N2K	possibly damaging	Het
Slc12a4	G	A	8: 105,945,706	A821V	probably damaging	Het
Slc41a1	A	G	1: 131,840,234	M179V	probably benign	Het
Tenm4	G	A	7: 96,873,711	V1450I	probably damaging	Het
Trmt1l	A	G	1: 151,457,580	N642S	possibly damaging	Het
Ttll13	G	A	7: 80,258,743	R576H	probably damaging	Het
Zar1	T	A	5: 72,580,929	R43S	probably benign	Het
Zfp455	A	G	13: 67,207,193	Y175C	probably damaging	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
R9741:Slc9a3	UTSW	13	74158875	missense	possibly damaging	0.95
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAAGGTCACCAGTATCGTCC -3'
(R):5'- TTACTTAAGTAGTCCACAGAGACACTG -3'

Sequencing Primer
(F):5'- AGTGCTCTACTCATCGTTCTGGG -3'
(R):5'- GAGACACTGCCCGTCATC -3'

Posted On

2017-07-14