Incidental Mutation 'R6060:Slc9a3'
ID 483204
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission 044426-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6060 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74150885 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 141 (Y141C)
Ref Sequence ENSEMBL: ENSMUSP00000153255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: Y141C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225423
AA Change: Y141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8837:Slc9a3 UTSW 13 74157704 missense probably damaging 1.00
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
R9741:Slc9a3 UTSW 13 74158875 missense possibly damaging 0.95
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAGGTCACCAGTATCGTCC -3'
(R):5'- TTACTTAAGTAGTCCACAGAGACACTG -3'

Sequencing Primer
(F):5'- AGTGCTCTACTCATCGTTCTGGG -3'
(R):5'- GAGACACTGCCCGTCATC -3'
Posted On 2017-07-14