Incidental Mutation 'R6060:Lpxn'
ID483211
Institutional Source Beutler Lab
Gene Symbol Lpxn
Ensembl Gene ENSMUSG00000024696
Gene Nameleupaxin
Synonyms4933402K05Rik, A530083L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6060 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12798606-12833807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12833125 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 311 (L311P)
Ref Sequence ENSEMBL: ENSMUSP00000025601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025601
AA Change: L311P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025601
Gene: ENSMUSG00000024696
AA Change: L311P

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
LIM 151 202 3.17e-17 SMART
LIM 210 261 1.98e-18 SMART
LIM 269 320 3.26e-19 SMART
LIM 328 379 3.34e-16 SMART
Meta Mutation Damage Score 0.7158 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is preferentially expressed in hematopoietic cells and belongs to the paxillin protein family. Similar to other members of this focal-adhesion-associated adaptor-protein family, it has four leucine-rich LD-motifs in the N-terminus and four LIM domains in the C-terminus. It may function in cell type-specific signaling by associating with PYK2, a member of focal adhesion kinase family. As a substrate for a tyrosine kinase in lymphoid cells, this protein may also function in, and be regulated by, tyrosine kinase activity. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lrp1b A T 2: 40,750,934 N3499K probably benign Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L possibly damaging Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Lpxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lpxn APN 19 12833086 missense probably damaging 0.99
IGL03088:Lpxn APN 19 12833211 missense probably damaging 1.00
IGL03203:Lpxn APN 19 12819406 missense probably benign 0.01
mascherano UTSW 19 12833172 missense probably damaging 0.99
R0848:Lpxn UTSW 19 12804037 missense probably benign
R1514:Lpxn UTSW 19 12824050 missense probably damaging 1.00
R1532:Lpxn UTSW 19 12804092 critical splice donor site probably null
R1880:Lpxn UTSW 19 12804088 missense probably benign 0.17
R1937:Lpxn UTSW 19 12824910 missense probably benign 0.00
R2182:Lpxn UTSW 19 12832758 critical splice donor site probably null
R2897:Lpxn UTSW 19 12819358 missense probably benign 0.01
R4194:Lpxn UTSW 19 12833235 missense probably damaging 1.00
R4576:Lpxn UTSW 19 12833290 missense probably benign 0.17
R4844:Lpxn UTSW 19 12833172 missense probably damaging 0.99
R5567:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R5570:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R6366:Lpxn UTSW 19 12824799 missense probably benign 0.12
R6615:Lpxn UTSW 19 12824799 missense probably benign 0.12
R7116:Lpxn UTSW 19 12811258 missense probably benign 0.28
R7135:Lpxn UTSW 19 12833319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCACACAGAACCAATTGTG -3'
(R):5'- GCTCCTTGAAGATGCCTTTCGG -3'

Sequencing Primer
(F):5'- CCAATTGTGGGCCTTTGCAG -3'
(R):5'- CCTTTCGGCAGCTGTGTCAG -3'
Posted On2017-07-14