Incidental Mutation 'R6061:Ifi205'
ID 483214
Institutional Source Beutler Lab
Gene Symbol Ifi205
Ensembl Gene ENSMUSG00000054203
Gene Name interferon activated gene 205
Synonyms D3
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 173839564-173859376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 173854830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000062409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059226]
AlphaFold Q8CGE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059226
AA Change: T110A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062409
Gene: ENSMUSG00000054203
AA Change: T110A

DomainStartEndE-ValueType
PYRIN 6 84 9.42e-13 SMART
low complexity region 102 112 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 168 185 N/A INTRINSIC
Pfam:HIN 204 372 2e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192166
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Ifi205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ifi205 APN 1 173,854,899 (GRCm39) splice site probably benign
IGL02419:Ifi205 APN 1 173,845,180 (GRCm39) missense probably damaging 0.99
IGL02476:Ifi205 APN 1 173,842,627 (GRCm39) missense probably damaging 1.00
IGL03128:Ifi205 APN 1 173,842,652 (GRCm39) missense probably damaging 0.99
IGL03154:Ifi205 APN 1 173,845,232 (GRCm39) splice site probably benign
R0211:Ifi205 UTSW 1 173,855,994 (GRCm39) missense probably benign
R1932:Ifi205 UTSW 1 173,855,980 (GRCm39) missense possibly damaging 0.47
R2397:Ifi205 UTSW 1 173,845,141 (GRCm39) missense possibly damaging 0.64
R3115:Ifi205 UTSW 1 173,855,901 (GRCm39) missense possibly damaging 0.95
R4534:Ifi205 UTSW 1 173,845,207 (GRCm39) missense probably benign 0.16
R4544:Ifi205 UTSW 1 173,854,139 (GRCm39) missense possibly damaging 0.96
R4715:Ifi205 UTSW 1 173,855,887 (GRCm39) missense possibly damaging 0.51
R4977:Ifi205 UTSW 1 173,842,574 (GRCm39) missense probably benign 0.07
R5844:Ifi205 UTSW 1 173,854,258 (GRCm39) splice site probably null
R6510:Ifi205 UTSW 1 173,845,131 (GRCm39) missense probably damaging 1.00
R7032:Ifi205 UTSW 1 173,855,916 (GRCm39) missense possibly damaging 0.80
R7196:Ifi205 UTSW 1 173,854,109 (GRCm39) missense probably damaging 0.96
R7244:Ifi205 UTSW 1 173,845,210 (GRCm39) nonsense probably null
R7419:Ifi205 UTSW 1 173,855,874 (GRCm39) missense possibly damaging 0.71
R7431:Ifi205 UTSW 1 173,855,943 (GRCm39) missense probably benign
R7660:Ifi205 UTSW 1 173,855,814 (GRCm39) missense probably benign 0.27
R7787:Ifi205 UTSW 1 173,842,644 (GRCm39) missense probably damaging 1.00
R7787:Ifi205 UTSW 1 173,842,640 (GRCm39) missense probably damaging 1.00
R9069:Ifi205 UTSW 1 173,855,841 (GRCm39) missense probably benign
R9163:Ifi205 UTSW 1 173,844,988 (GRCm39) missense possibly damaging 0.88
R9348:Ifi205 UTSW 1 173,844,997 (GRCm39) missense probably benign 0.24
R9376:Ifi205 UTSW 1 173,854,221 (GRCm39) missense probably benign
R9477:Ifi205 UTSW 1 173,854,155 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGATCAGTTATCCTCTGAGC -3'
(R):5'- CAAAGCTTGTGCCTTTGGTGC -3'

Sequencing Primer
(F):5'- CCTCTGAGCTTCAATAAAAACTTGC -3'
(R):5'- CTATGTCGCTAGAGTAAGCTATGGAC -3'
Posted On 2017-07-14