Incidental Mutation 'R6061:Ifi205'
ID 483214
Institutional Source Beutler Lab
Gene Symbol Ifi205
Ensembl Gene ENSMUSG00000054203
Gene Name interferon activated gene 205
Synonyms D3
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 174011998-174031810 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 174027264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000062409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059226]
AlphaFold Q8CGE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059226
AA Change: T110A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062409
Gene: ENSMUSG00000054203
AA Change: T110A

DomainStartEndE-ValueType
PYRIN 6 84 9.42e-13 SMART
low complexity region 102 112 N/A INTRINSIC
low complexity region 121 134 N/A INTRINSIC
low complexity region 168 185 N/A INTRINSIC
Pfam:HIN 204 372 2e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192166
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Ifi205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ifi205 APN 1 174027333 splice site probably benign
IGL02419:Ifi205 APN 1 174017614 missense probably damaging 0.99
IGL02476:Ifi205 APN 1 174015061 missense probably damaging 1.00
IGL03128:Ifi205 APN 1 174015086 missense probably damaging 0.99
IGL03154:Ifi205 APN 1 174017666 splice site probably benign
R0211:Ifi205 UTSW 1 174028428 missense probably benign
R1932:Ifi205 UTSW 1 174028414 missense possibly damaging 0.47
R2397:Ifi205 UTSW 1 174017575 missense possibly damaging 0.64
R3115:Ifi205 UTSW 1 174028335 missense possibly damaging 0.95
R4534:Ifi205 UTSW 1 174017641 missense probably benign 0.16
R4544:Ifi205 UTSW 1 174026573 missense possibly damaging 0.96
R4715:Ifi205 UTSW 1 174028321 missense possibly damaging 0.51
R4977:Ifi205 UTSW 1 174015008 missense probably benign 0.07
R5844:Ifi205 UTSW 1 174026692 splice site probably null
R6510:Ifi205 UTSW 1 174017565 missense probably damaging 1.00
R7032:Ifi205 UTSW 1 174028350 missense possibly damaging 0.80
R7196:Ifi205 UTSW 1 174026543 missense probably damaging 0.96
R7244:Ifi205 UTSW 1 174017644 nonsense probably null
R7419:Ifi205 UTSW 1 174028308 missense possibly damaging 0.71
R7431:Ifi205 UTSW 1 174028377 missense probably benign
R7660:Ifi205 UTSW 1 174028248 missense probably benign 0.27
R7787:Ifi205 UTSW 1 174015074 missense probably damaging 1.00
R7787:Ifi205 UTSW 1 174015078 missense probably damaging 1.00
R9069:Ifi205 UTSW 1 174028275 missense probably benign
R9163:Ifi205 UTSW 1 174017422 missense possibly damaging 0.88
R9348:Ifi205 UTSW 1 174017431 missense probably benign 0.24
R9376:Ifi205 UTSW 1 174026655 missense probably benign
R9477:Ifi205 UTSW 1 174026589 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGATCAGTTATCCTCTGAGC -3'
(R):5'- CAAAGCTTGTGCCTTTGGTGC -3'

Sequencing Primer
(F):5'- CCTCTGAGCTTCAATAAAAACTTGC -3'
(R):5'- CTATGTCGCTAGAGTAAGCTATGGAC -3'
Posted On 2017-07-14