Incidental Mutation 'R6061:Med27'
ID 483216
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Name mediator complex subunit 27
Synonyms D2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 29346819-29524793 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29509441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 95 (S95T)
Ref Sequence ENSEMBL: ENSMUSP00000125360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000159280] [ENSMUST00000162597]
AlphaFold Q9DB40
Predicted Effect probably benign
Transcript: ENSMUST00000028139
AA Change: S234T

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799
AA Change: S234T

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147547
Predicted Effect probably benign
Transcript: ENSMUST00000159280
AA Change: S95T

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799
AA Change: S95T

DomainStartEndE-ValueType
Pfam:Med27 85 171 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162597
AA Change: S95T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R0427:Med27 UTSW 2 29500271 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R3196:Med27 UTSW 2 29346870 missense possibly damaging 0.86
R4093:Med27 UTSW 2 29377908 unclassified probably benign
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R5870:Med27 UTSW 2 29389811 critical splice acceptor site probably null
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
R7671:Med27 UTSW 2 29377938 missense
R8255:Med27 UTSW 2 29524364 splice site probably null
R8969:Med27 UTSW 2 29346863 missense possibly damaging 0.86
R9026:Med27 UTSW 2 29509434 nonsense probably null
R9194:Med27 UTSW 2 29471300 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAGATGACCTCAGATCCCTTC -3'
(R):5'- TTCCCCATGTCATATAAATGCAGG -3'

Sequencing Primer
(F):5'- AGATGACCTCAGATCCCTTCATTCC -3'
(R):5'- CATATAAATGCAGGTCAGGTTGCCC -3'
Posted On 2017-07-14