Incidental Mutation 'R6061:Phf19'
ID 483217
Institutional Source Beutler Lab
Gene Symbol Phf19
Ensembl Gene ENSMUSG00000026873
Gene Name PHD finger protein 19
Synonyms 3321402G02Rik, 3110009G19Rik
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6061 (G1)
Quality Score 113.008
Status Not validated
Chromosome 2
Chromosomal Location 34783769-34804038 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34787129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 445 (D445V)
Ref Sequence ENSEMBL: ENSMUSP00000028232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028228] [ENSMUST00000028232]
AlphaFold Q9CXG9
Predicted Effect probably benign
Transcript: ENSMUST00000028228
SMART Domains Protein: ENSMUSP00000028228
Gene: ENSMUSG00000026870

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:CutA1 53 109 2.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028228
SMART Domains Protein: ENSMUSP00000144258
Gene: ENSMUSG00000026870

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:CutA1 54 110 9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028232
AA Change: D445V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028232
Gene: ENSMUSG00000026873
AA Change: D445V

DomainStartEndE-ValueType
TUDOR 36 93 2.33e-8 SMART
PHD 96 147 2.87e-5 SMART
low complexity region 154 165 N/A INTRINSIC
PHD 195 245 2.11e-3 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Pfam:Mtf2_C 529 576 5.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129911
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Phf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Phf19 APN 2 34,787,119 (GRCm39) missense probably damaging 0.99
IGL01862:Phf19 APN 2 34,787,067 (GRCm39) critical splice donor site probably null
R0079:Phf19 UTSW 2 34,785,966 (GRCm39) missense probably benign
R0183:Phf19 UTSW 2 34,801,214 (GRCm39) missense probably damaging 1.00
R1289:Phf19 UTSW 2 34,786,042 (GRCm39) missense probably benign
R1632:Phf19 UTSW 2 34,801,631 (GRCm39) missense probably damaging 1.00
R1829:Phf19 UTSW 2 34,801,781 (GRCm39) missense probably benign 0.00
R2057:Phf19 UTSW 2 34,789,620 (GRCm39) missense probably benign 0.06
R2475:Phf19 UTSW 2 34,785,807 (GRCm39) missense probably benign
R3039:Phf19 UTSW 2 34,795,534 (GRCm39) missense probably benign 0.26
R3803:Phf19 UTSW 2 34,789,670 (GRCm39) missense probably damaging 0.99
R3804:Phf19 UTSW 2 34,789,670 (GRCm39) missense probably damaging 0.99
R4885:Phf19 UTSW 2 34,789,718 (GRCm39) missense probably damaging 0.99
R5759:Phf19 UTSW 2 34,787,135 (GRCm39) missense probably damaging 1.00
R6949:Phf19 UTSW 2 34,794,143 (GRCm39) missense probably damaging 1.00
R7080:Phf19 UTSW 2 34,788,724 (GRCm39) splice site probably null
R7730:Phf19 UTSW 2 34,785,816 (GRCm39) missense probably damaging 1.00
R7956:Phf19 UTSW 2 34,796,567 (GRCm39) missense possibly damaging 0.84
R8900:Phf19 UTSW 2 34,795,484 (GRCm39) missense probably damaging 0.99
R9500:Phf19 UTSW 2 34,801,708 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTAGAGGGATCACATAGCCAC -3'
(R):5'- AGTCGGCTCTGATGACTGAATG -3'

Sequencing Primer
(F):5'- GGATCACATAGCCACTGCAGG -3'
(R):5'- CTCTGATGACTGAATGGTGAAAAAGC -3'
Posted On 2017-07-14