Incidental Mutation 'R6061:Olfr996'
ID 483218
Institutional Source Beutler Lab
Gene Symbol Olfr996
Ensembl Gene ENSMUSG00000111179
Gene Name olfactory receptor 996
Synonyms GA_x6K02T2Q125-47058060-47059004, MOR175-4
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85579215-85580282 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85579542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 101 (M101K)
Ref Sequence ENSEMBL: ENSMUSP00000076330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077075]
AlphaFold Q7TRA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000077075
AA Change: M101K

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076330
Gene: ENSMUSG00000111179
AA Change: M101K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-52 PFAM
Pfam:7tm_1 41 290 2.7e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Olfr996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Olfr996 APN 2 85579531 nonsense probably null
IGL01972:Olfr996 APN 2 85579773 missense probably damaging 1.00
IGL02102:Olfr996 APN 2 85579673 missense probably damaging 0.98
IGL03159:Olfr996 APN 2 85579940 missense probably damaging 0.99
R0539:Olfr996 UTSW 2 85579775 missense probably damaging 0.99
R4275:Olfr996 UTSW 2 85579863 missense probably benign 0.07
R4561:Olfr996 UTSW 2 85579620 missense probably damaging 0.99
R4953:Olfr996 UTSW 2 85579725 nonsense probably null
R5794:Olfr996 UTSW 2 85579341 missense probably benign 0.03
R6695:Olfr996 UTSW 2 85579449 missense probably damaging 1.00
R6981:Olfr996 UTSW 2 85579481 missense probably benign 0.06
R7030:Olfr996 UTSW 2 85579402 missense possibly damaging 0.56
R7399:Olfr996 UTSW 2 85579296 missense probably benign 0.00
R8914:Olfr996 UTSW 2 85579712 missense possibly damaging 0.72
R9594:Olfr996 UTSW 2 85579538 nonsense probably null
R9686:Olfr996 UTSW 2 85579996 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTGGGGATGATCGCTCTC -3'
(R):5'- GTCAGAACATGCTAGAGACAGC -3'

Sequencing Primer
(F):5'- TCTCATATGGTTGGACCCCAGG -3'
(R):5'- GTGGTTGATAATATATGGACCACAG -3'
Posted On 2017-07-14