Mutagenetix > Incidental Mutations

Incidental Mutation 'R6061:Tiparp'

483220

Institutional Source

Beutler Lab

Gene Symbol

Tiparp

Ensembl Gene

ENSMUSG00000034640

Gene Name

TCDD-inducible poly(ADP-ribose) polymerase

Synonyms

PARP7, PARP-7, DDF1

MMRRC Submission

044226-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R6061 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65528410-65555518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65553243 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 551 (V551A)

Ref Sequence

ENSEMBL: ENSMUSP00000048051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047906]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047906
AA Change: V551A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: V551A

Domain	Start	End	E-Value	Type
Blast:ZnF_C3H1	238	264	2e-8	BLAST
Pfam:PARP	463	650	2e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154094

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	C	6: 128,568,712	F484C	probably damaging	Het
Cdsn	A	G	17: 35,554,906	S111G	unknown	Het
Ctnnal1	T	C	4: 56,812,349	T726A	probably benign	Het
Cyp2j11	T	A	4: 96,348,616		probably benign	Het
Ddx60	T	A	8: 62,023,241	M1541K	probably null	Het
Dnah14	C	T	1: 181,709,051	P2420S	probably damaging	Het
Doxl2	A	C	6: 48,976,601	I487L	probably benign	Het
Fhit	T	C	14: 9,573,435	E205G	probably benign	Het
Glipr1l1	C	T	10: 112,076,170	T203M	probably benign	Het
Gm4353	T	A	7: 116,084,269	D97V	probably benign	Het
Gprc6a	A	T	10: 51,615,811	I543K	probably damaging	Het
Ifi205	T	C	1: 174,027,264	T110A	possibly damaging	Het
Med27	T	A	2: 29,509,441	S95T	probably damaging	Het
Mocs1	T	C	17: 49,450,313	S308P	probably damaging	Het
Mrpl11	C	T	19: 4,963,369	S88F	possibly damaging	Het
Nav3	A	T	10: 109,866,984	Y229*	probably null	Het
Olfr138	A	G	17: 38,274,881	M37V	probably benign	Het
Olfr38	A	T	6: 42,762,965	L304F	probably damaging	Het
Olfr569	C	A	7: 102,887,951	L67F	probably benign	Het
Olfr668	C	T	7: 104,925,392	R124H	probably benign	Het
Olfr996	T	A	2: 85,579,542	M101K	possibly damaging	Het
Pear1	A	G	3: 87,755,931	I460T	probably benign	Het
Phc3	T	A	3: 30,914,529	K816N	probably damaging	Het
Phf19	T	A	2: 34,897,117	D445V	probably damaging	Het
Pkd2l2	T	C	18: 34,430,689	F486L	probably damaging	Het
Plagl1	G	T	10: 13,127,895		probably benign	Het
Prkca	A	G	11: 108,057,845	I106T	probably benign	Het
Ptpn3	C	T	4: 57,248,681	G218R	probably damaging	Het
Ptx3	A	G	3: 66,224,709	D217G	possibly damaging	Het
Rab3d	T	C	9: 21,910,519	T209A	probably benign	Het
Rfx2	A	G	17: 56,777,473	F642S	possibly damaging	Het
Rhpn2	T	A	7: 35,376,211	M271K	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,994	T259A	probably damaging	Het
Speer3	G	A	5: 13,794,691	V123M	possibly damaging	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Thbs4	A	G	13: 92,751,795	F950L	probably benign	Het
Vmn2r71	T	A	7: 85,619,274	D228E	probably benign	Het
Vmn2r85	T	C	10: 130,425,662	I269V	probably benign	Het
Vps9d1	A	T	8: 123,245,671	M497K	probably damaging	Het
Wnt5b	A	G	6: 119,433,642	V241A	probably damaging	Het
Xdh	T	C	17: 73,921,347	N353S	probably damaging	Het
Zfp526	C	T	7: 25,226,332	T672M	probably damaging	Het

Other mutations in Tiparp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Tiparp	APN	3	65532109	missense	probably damaging	1.00
IGL01448:Tiparp	APN	3	65552609	nonsense	probably null
IGL01452:Tiparp	APN	3	65552609	nonsense	probably null
IGL01454:Tiparp	APN	3	65552609	nonsense	probably null
IGL01456:Tiparp	APN	3	65552609	nonsense	probably null
IGL01463:Tiparp	APN	3	65552609	nonsense	probably null
IGL01467:Tiparp	APN	3	65552609	nonsense	probably null
IGL01468:Tiparp	APN	3	65552609	nonsense	probably null
IGL01470:Tiparp	APN	3	65552609	nonsense	probably null
IGL01476:Tiparp	APN	3	65552609	nonsense	probably null
IGL01481:Tiparp	APN	3	65552609	nonsense	probably null
IGL01590:Tiparp	APN	3	65531976	missense	probably benign	0.14
IGL01684:Tiparp	APN	3	65553333	missense	probably damaging	0.99
IGL02322:Tiparp	APN	3	65532020	nonsense	probably null
IGL02572:Tiparp	APN	3	65531889	missense	probably benign	0.01
R0401:Tiparp	UTSW	3	65531436	missense	probably benign	0.06
R0674:Tiparp	UTSW	3	65553165	missense	probably benign	0.03
R1316:Tiparp	UTSW	3	65553351	missense	probably damaging	1.00
R1766:Tiparp	UTSW	3	65532049	missense	probably damaging	1.00
R2140:Tiparp	UTSW	3	65529252	intron	probably benign
R2568:Tiparp	UTSW	3	65553130	nonsense	probably null
R4533:Tiparp	UTSW	3	65546347	missense	probably benign	0.05
R4751:Tiparp	UTSW	3	65552804	missense	probably damaging	1.00
R4812:Tiparp	UTSW	3	65552769	missense	possibly damaging	0.94
R5268:Tiparp	UTSW	3	65547565	missense	possibly damaging	0.72
R5622:Tiparp	UTSW	3	65547525	missense	probably benign	0.00
R5693:Tiparp	UTSW	3	65553492	missense	possibly damaging	0.89
R5765:Tiparp	UTSW	3	65531350	missense	possibly damaging	0.69
R6875:Tiparp	UTSW	3	65531642	missense	probably benign	0.01
R7123:Tiparp	UTSW	3	65553527	missense	probably damaging	1.00
R8023:Tiparp	UTSW	3	65531803	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCTGTTTCTGCAGAAGATAAAAG -3'
(R):5'- ACACAAGAGTCATATAAGTCACTGGTG -3'

Sequencing Primer
(F):5'- TGAGAGTCCAAAACCAATTTCTTTG -3'
(R):5'- TGACACTGCCAGGGTTGAC -3'

Posted On

2017-07-14