Incidental Mutation 'R6061:Tiparp'
ID483220
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R6061 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65553243 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 551 (V551A)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906]
Predicted Effect probably damaging
Transcript: ENSMUST00000047906
AA Change: V551A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: V551A

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154094
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1316:Tiparp UTSW 3 65553351 missense probably damaging 1.00
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5693:Tiparp UTSW 3 65553492 missense possibly damaging 0.89
R5765:Tiparp UTSW 3 65531350 missense possibly damaging 0.69
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTTCTGCAGAAGATAAAAG -3'
(R):5'- ACACAAGAGTCATATAAGTCACTGGTG -3'

Sequencing Primer
(F):5'- TGAGAGTCCAAAACCAATTTCTTTG -3'
(R):5'- TGACACTGCCAGGGTTGAC -3'
Posted On2017-07-14