Incidental Mutation 'R6061:Ptx3'
ID 483221
Institutional Source Beutler Lab
Gene Symbol Ptx3
Ensembl Gene ENSMUSG00000027832
Gene Name pentraxin related gene
Synonyms TSG-14, pentraxin 3
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 66127331-66133226 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66132130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 217 (D217G)
Ref Sequence ENSEMBL: ENSMUSP00000029421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029419] [ENSMUST00000029421]
AlphaFold P48759
Predicted Effect probably benign
Transcript: ENSMUST00000029419
SMART Domains Protein: ENSMUSP00000029419
Gene: ENSMUSG00000027831

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Blast:PH 586 626 1e-5 BLAST
PH 717 821 1.44e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000029421
AA Change: D217G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029421
Gene: ENSMUSG00000027832
AA Change: D217G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 123 144 N/A INTRINSIC
PTX 175 381 5.82e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182521
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pentraxin protein family. The expression of this protein is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein promotes fibrocyte differentiation and is involved in regulating inflammation and complement activation. It also plays a role in angiogenesis and tissue remodeling. The protein serves as a biomarker for several inflammatory conditions. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice display female subfertility due to abnormalities of the cumulus oophorus and are susceptible to invasive pulmonary aspergillosis associated with defective recognition of conidia by alveolar macrophages and dendritic cells and impaired induction of adaptive type 2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Ptx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Ptx3 APN 3 66,132,196 (GRCm39) missense probably damaging 1.00
R0674:Ptx3 UTSW 3 66,132,148 (GRCm39) missense probably damaging 1.00
R1966:Ptx3 UTSW 3 66,132,042 (GRCm39) missense probably damaging 1.00
R2114:Ptx3 UTSW 3 66,132,187 (GRCm39) missense probably damaging 1.00
R2116:Ptx3 UTSW 3 66,132,187 (GRCm39) missense probably damaging 1.00
R3717:Ptx3 UTSW 3 66,132,376 (GRCm39) missense probably benign 0.01
R4222:Ptx3 UTSW 3 66,132,127 (GRCm39) missense probably damaging 1.00
R4898:Ptx3 UTSW 3 66,132,412 (GRCm39) missense probably damaging 1.00
R5426:Ptx3 UTSW 3 66,128,143 (GRCm39) missense probably damaging 0.99
R5942:Ptx3 UTSW 3 66,127,484 (GRCm39) start codon destroyed probably null 1.00
R6216:Ptx3 UTSW 3 66,132,265 (GRCm39) missense probably damaging 1.00
R7165:Ptx3 UTSW 3 66,132,391 (GRCm39) missense probably benign 0.03
R7253:Ptx3 UTSW 3 66,132,368 (GRCm39) missense probably benign 0.03
R8411:Ptx3 UTSW 3 66,132,201 (GRCm39) missense probably benign 0.14
R8458:Ptx3 UTSW 3 66,128,419 (GRCm39) missense probably benign 0.02
R8958:Ptx3 UTSW 3 66,128,391 (GRCm39) missense probably benign 0.11
R9046:Ptx3 UTSW 3 66,132,153 (GRCm39) missense probably damaging 0.99
Z1176:Ptx3 UTSW 3 66,128,256 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGAGGCCCCATGAGTCATAAC -3'
(R):5'- GCCATCTCTACAGTGGTAGC -3'

Sequencing Primer
(F):5'- CCCATGAGTCATAACACAGCAG -3'
(R):5'- TGCTCTGAACTCCAGGTGC -3'
Posted On 2017-07-14