Incidental Mutation 'R6061:Ptpn3'
ID 483224
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Name protein tyrosine phosphatase, non-receptor type 3
Synonyms 9530011I20Rik, PTPCL, PTP-H1
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 57190841-57301837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57248681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 218 (G218R)
Ref Sequence ENSEMBL: ENSMUSP00000122490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637] [ENSMUST00000153926]
AlphaFold A2ALK8
Predicted Effect probably damaging
Transcript: ENSMUST00000075637
AA Change: G218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: G218R

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153926
AA Change: G218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122490
Gene: ENSMUSG00000038764
AA Change: G218R

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57270050 missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57240833 missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57225775 missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57254915 critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57197576 missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57222019 missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57197510 missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57205020 missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57222020 missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57270118 missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0310:Ptpn3 UTSW 4 57204958 missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57194304 missense probably benign
R0631:Ptpn3 UTSW 4 57204921 missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57270075 missense probably benign 0.41
R1443:Ptpn3 UTSW 4 57225775 missense probably benign 0.01
R1741:Ptpn3 UTSW 4 57254922 missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57239682 missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57270144 missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57235355 missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57270119 missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57197568 missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57218513 missense possibly damaging 0.93
R5410:Ptpn3 UTSW 4 57205019 missense probably damaging 1.00
R5554:Ptpn3 UTSW 4 57240843 missense probably damaging 0.99
R6024:Ptpn3 UTSW 4 57248653 splice site probably null
R6212:Ptpn3 UTSW 4 57270070 missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57265012 missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57249981 missense probably benign
R6444:Ptpn3 UTSW 4 57195730 missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57265104 splice site probably null
R6656:Ptpn3 UTSW 4 57205905 missense probably damaging 0.99
R6730:Ptpn3 UTSW 4 57270088 missense probably benign
R7133:Ptpn3 UTSW 4 57225863 missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57245062 missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57239625 missense probably damaging 1.00
R7368:Ptpn3 UTSW 4 57221993 missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57240845 missense probably damaging 0.99
R7742:Ptpn3 UTSW 4 57265092 critical splice acceptor site probably null
R8023:Ptpn3 UTSW 4 57248688 missense probably benign 0.02
R8099:Ptpn3 UTSW 4 57204985 nonsense probably null
R8155:Ptpn3 UTSW 4 57232336 missense probably benign
R8302:Ptpn3 UTSW 4 57218514 missense probably benign 0.01
R8315:Ptpn3 UTSW 4 57270063 missense possibly damaging 0.88
R8335:Ptpn3 UTSW 4 57235286 missense probably damaging 0.99
R8346:Ptpn3 UTSW 4 57225547 missense probably damaging 0.99
R8348:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8448:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8513:Ptpn3 UTSW 4 57270085 nonsense probably null
R8846:Ptpn3 UTSW 4 57205020 missense probably damaging 1.00
R9244:Ptpn3 UTSW 4 57254915 critical splice donor site probably null
R9337:Ptpn3 UTSW 4 57218521 missense probably damaging 0.96
R9478:Ptpn3 UTSW 4 57197573 missense probably damaging 1.00
R9500:Ptpn3 UTSW 4 57205914 missense possibly damaging 0.83
R9710:Ptpn3 UTSW 4 57249957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTAAACCCCTGAGGCGAC -3'
(R):5'- AGGTCAGGTTCCATGGACAAG -3'

Sequencing Primer
(F):5'- GGCGACTCTCTAGCCCCTAAATAG -3'
(R):5'- CTAGAGTGCTTACGGGGGAC -3'
Posted On 2017-07-14