Incidental Mutation 'R6061:Zfp526'
ID 483231
Institutional Source Beutler Lab
Gene Symbol Zfp526
Ensembl Gene ENSMUSG00000046541
Gene Name zinc finger protein 526
Synonyms D030024H03Rik
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 25221425-25227507 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25226332 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 672 (T672M)
Ref Sequence ENSEMBL: ENSMUSP00000053567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055604] [ENSMUST00000071739] [ENSMUST00000108411]
AlphaFold Q8BI66
Predicted Effect probably damaging
Transcript: ENSMUST00000055604
AA Change: T672M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053567
Gene: ENSMUSG00000046541
AA Change: T672M

DomainStartEndE-ValueType
ZnF_C2H2 56 78 1.41e0 SMART
low complexity region 79 90 N/A INTRINSIC
ZnF_C2H2 108 130 9.46e0 SMART
ZnF_C2H2 140 163 4.65e-1 SMART
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 200 222 4.72e-2 SMART
coiled coil region 234 254 N/A INTRINSIC
ZnF_C2H2 280 303 1.26e1 SMART
ZnF_C2H2 312 334 3.29e-1 SMART
ZnF_C2H2 339 361 6.78e-3 SMART
ZnF_C2H2 367 389 4.65e-1 SMART
ZnF_C2H2 395 416 3.56e1 SMART
ZnF_C2H2 447 470 8.47e-4 SMART
ZnF_C2H2 477 499 2.05e-2 SMART
ZnF_C2H2 505 527 2.09e-3 SMART
ZnF_C2H2 533 555 5.99e-4 SMART
ZnF_C2H2 578 600 8.22e-2 SMART
low complexity region 610 624 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071739
SMART Domains Protein: ENSMUSP00000071654
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 481 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108411
SMART Domains Protein: ENSMUSP00000104049
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 477 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169914
SMART Domains Protein: ENSMUSP00000126890
Gene: ENSMUSG00000090330

DomainStartEndE-ValueType
low complexity region 77 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206654
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Other mutations in Zfp526
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Zfp526 APN 7 25225533 missense possibly damaging 0.89
IGL02983:Zfp526 APN 7 25224415 missense probably benign 0.27
IGL03123:Zfp526 APN 7 25224624 missense probably benign
R0456:Zfp526 UTSW 7 25226212 missense probably damaging 1.00
R1269:Zfp526 UTSW 7 25224363 missense probably benign
R1542:Zfp526 UTSW 7 25226262 missense probably benign 0.12
R1668:Zfp526 UTSW 7 25225542 missense probably benign 0.15
R1742:Zfp526 UTSW 7 25224514 missense possibly damaging 0.93
R1870:Zfp526 UTSW 7 25225169 missense possibly damaging 0.67
R3791:Zfp526 UTSW 7 25226203 missense probably damaging 0.98
R4755:Zfp526 UTSW 7 25225639 missense probably benign 0.00
R4833:Zfp526 UTSW 7 25225870 missense probably damaging 1.00
R5549:Zfp526 UTSW 7 25225684 missense possibly damaging 0.82
R5853:Zfp526 UTSW 7 25225176 nonsense probably null
R6186:Zfp526 UTSW 7 25226136 missense probably benign
R7270:Zfp526 UTSW 7 25225920 missense probably damaging 1.00
R7882:Zfp526 UTSW 7 25221435 unclassified probably benign
R8084:Zfp526 UTSW 7 25225312 missense probably damaging 0.99
R9016:Zfp526 UTSW 7 25225839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGTTTGACCCTGCAG -3'
(R):5'- TTCATCTGGGGCAGGGAAAG -3'

Sequencing Primer
(F):5'- AGTTTGACCCTGCAGCCTCC -3'
(R):5'- GGTAACAGGAGGAACCCTGAG -3'
Posted On 2017-07-14