Incidental Mutation 'R6061:Rhpn2'
ID 483232
Institutional Source Beutler Lab
Gene Symbol Rhpn2
Ensembl Gene ENSMUSG00000030494
Gene Name rhophilin, Rho GTPase binding protein 2
Synonyms D7Ertd784e, 1300002E07Rik
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 35033605-35091712 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35075636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 271 (M271K)
Ref Sequence ENSEMBL: ENSMUSP00000082692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032705] [ENSMUST00000085556]
AlphaFold Q8BWR8
Predicted Effect possibly damaging
Transcript: ENSMUST00000032705
AA Change: M271K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494
AA Change: M271K

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085556
AA Change: M271K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494
AA Change: M271K

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155140
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhophilin family of Ras-homologous (Rho)-GTPase binding proteins. The encoded protein binds both GTP- and GDP-bound RhoA and GTP-bound RhoB and may be involved in the organization of the actin cytoskeleton. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous null mice are fertile and have normal body weight and size, normal thyroid morphology and function, and normal brain, lung, ovary, testis, and kidney morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Rhpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Rhpn2 APN 7 35,070,185 (GRCm39) missense probably damaging 1.00
IGL01718:Rhpn2 APN 7 35,070,179 (GRCm39) missense probably benign 0.03
IGL01833:Rhpn2 APN 7 35,075,596 (GRCm39) missense probably benign 0.04
IGL02134:Rhpn2 APN 7 35,070,536 (GRCm39) splice site probably benign
IGL02725:Rhpn2 APN 7 35,079,031 (GRCm39) missense probably damaging 0.99
PIT4382001:Rhpn2 UTSW 7 35,090,178 (GRCm39) critical splice acceptor site probably null
R0433:Rhpn2 UTSW 7 35,084,899 (GRCm39) missense probably benign 0.00
R1659:Rhpn2 UTSW 7 35,076,466 (GRCm39) missense probably damaging 1.00
R1836:Rhpn2 UTSW 7 35,071,813 (GRCm39) missense probably benign 0.30
R2110:Rhpn2 UTSW 7 35,076,433 (GRCm39) missense probably benign 0.01
R2567:Rhpn2 UTSW 7 35,080,957 (GRCm39) critical splice donor site probably null
R4302:Rhpn2 UTSW 7 35,090,270 (GRCm39) missense probably benign 0.01
R4717:Rhpn2 UTSW 7 35,033,775 (GRCm39) missense possibly damaging 0.87
R4832:Rhpn2 UTSW 7 35,075,774 (GRCm39) critical splice donor site probably null
R4890:Rhpn2 UTSW 7 35,090,228 (GRCm39) missense probably benign 0.01
R5119:Rhpn2 UTSW 7 35,070,549 (GRCm39) missense probably damaging 1.00
R5285:Rhpn2 UTSW 7 35,080,990 (GRCm39) intron probably benign
R5563:Rhpn2 UTSW 7 35,070,652 (GRCm39) missense probably damaging 0.98
R5578:Rhpn2 UTSW 7 35,070,135 (GRCm39) missense probably damaging 1.00
R6405:Rhpn2 UTSW 7 35,071,864 (GRCm39) missense probably benign 0.02
R6700:Rhpn2 UTSW 7 35,075,594 (GRCm39) missense possibly damaging 0.91
R6776:Rhpn2 UTSW 7 35,083,194 (GRCm39) splice site probably null
R7326:Rhpn2 UTSW 7 35,084,888 (GRCm39) missense probably benign 0.00
R7342:Rhpn2 UTSW 7 35,033,771 (GRCm39) missense probably damaging 1.00
R7455:Rhpn2 UTSW 7 35,070,669 (GRCm39) splice site probably null
R7849:Rhpn2 UTSW 7 35,080,912 (GRCm39) missense probably benign 0.11
R8750:Rhpn2 UTSW 7 35,075,680 (GRCm39) missense probably benign 0.07
R8822:Rhpn2 UTSW 7 35,090,228 (GRCm39) missense probably benign 0.01
R8989:Rhpn2 UTSW 7 35,053,446 (GRCm39) intron probably benign
R9076:Rhpn2 UTSW 7 35,083,473 (GRCm39) splice site probably benign
R9308:Rhpn2 UTSW 7 35,033,805 (GRCm39) missense possibly damaging 0.87
Z1177:Rhpn2 UTSW 7 35,033,799 (GRCm39) missense probably benign 0.00
Z1177:Rhpn2 UTSW 7 35,033,798 (GRCm39) missense probably benign
Z1186:Rhpn2 UTSW 7 35,084,826 (GRCm39) missense probably benign 0.00
Z1191:Rhpn2 UTSW 7 35,084,826 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGGCTCCTGTAAGCTAAG -3'
(R):5'- AATAAACATAGGCCGGCCGC -3'

Sequencing Primer
(F):5'- GGCTCCTGTAAGCTAAGCACTC -3'
(R):5'- TCTGAGGACAGCTACAGTGTACTC -3'
Posted On 2017-07-14