Incidental Mutation 'R6061:Rhpn2'
ID 483232
Institutional Source Beutler Lab
Gene Symbol Rhpn2
Ensembl Gene ENSMUSG00000030494
Gene Name rhophilin, Rho GTPase binding protein 2
Synonyms D7Ertd784e, 1300002E07Rik
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 35334170-35392289 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35376211 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 271 (M271K)
Ref Sequence ENSEMBL: ENSMUSP00000082692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032705] [ENSMUST00000085556]
AlphaFold Q8BWR8
Predicted Effect possibly damaging
Transcript: ENSMUST00000032705
AA Change: M271K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494
AA Change: M271K

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085556
AA Change: M271K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494
AA Change: M271K

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155140
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhophilin family of Ras-homologous (Rho)-GTPase binding proteins. The encoded protein binds both GTP- and GDP-bound RhoA and GTP-bound RhoB and may be involved in the organization of the actin cytoskeleton. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous null mice are fertile and have normal body weight and size, normal thyroid morphology and function, and normal brain, lung, ovary, testis, and kidney morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Rhpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Rhpn2 APN 7 35370760 missense probably damaging 1.00
IGL01718:Rhpn2 APN 7 35370754 missense probably benign 0.03
IGL01833:Rhpn2 APN 7 35376171 missense probably benign 0.04
IGL02134:Rhpn2 APN 7 35371111 splice site probably benign
IGL02725:Rhpn2 APN 7 35379606 missense probably damaging 0.99
PIT4382001:Rhpn2 UTSW 7 35390753 critical splice acceptor site probably null
R0433:Rhpn2 UTSW 7 35385474 missense probably benign 0.00
R1659:Rhpn2 UTSW 7 35377041 missense probably damaging 1.00
R1836:Rhpn2 UTSW 7 35372388 missense probably benign 0.30
R2110:Rhpn2 UTSW 7 35377008 missense probably benign 0.01
R2567:Rhpn2 UTSW 7 35381532 critical splice donor site probably null
R4302:Rhpn2 UTSW 7 35390845 missense probably benign 0.01
R4717:Rhpn2 UTSW 7 35334350 missense possibly damaging 0.87
R4832:Rhpn2 UTSW 7 35376349 critical splice donor site probably null
R4890:Rhpn2 UTSW 7 35390803 missense probably benign 0.01
R5119:Rhpn2 UTSW 7 35371124 missense probably damaging 1.00
R5285:Rhpn2 UTSW 7 35381565 intron probably benign
R5563:Rhpn2 UTSW 7 35371227 missense probably damaging 0.98
R5578:Rhpn2 UTSW 7 35370710 missense probably damaging 1.00
R6405:Rhpn2 UTSW 7 35372439 missense probably benign 0.02
R6700:Rhpn2 UTSW 7 35376169 missense possibly damaging 0.91
R6776:Rhpn2 UTSW 7 35383769 splice site probably null
R7326:Rhpn2 UTSW 7 35385463 missense probably benign 0.00
R7342:Rhpn2 UTSW 7 35334346 missense probably damaging 1.00
R7455:Rhpn2 UTSW 7 35371244 splice site probably null
R7849:Rhpn2 UTSW 7 35381487 missense probably benign 0.11
R8750:Rhpn2 UTSW 7 35376255 missense probably benign 0.07
R8822:Rhpn2 UTSW 7 35390803 missense probably benign 0.01
R8989:Rhpn2 UTSW 7 35354021 intron probably benign
R9076:Rhpn2 UTSW 7 35384048 splice site probably benign
R9308:Rhpn2 UTSW 7 35334380 missense possibly damaging 0.87
Z1177:Rhpn2 UTSW 7 35334373 missense probably benign
Z1177:Rhpn2 UTSW 7 35334374 missense probably benign 0.00
Z1186:Rhpn2 UTSW 7 35385401 missense probably benign 0.00
Z1191:Rhpn2 UTSW 7 35385401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGGCTCCTGTAAGCTAAG -3'
(R):5'- AATAAACATAGGCCGGCCGC -3'

Sequencing Primer
(F):5'- GGCTCCTGTAAGCTAAGCACTC -3'
(R):5'- TCTGAGGACAGCTACAGTGTACTC -3'
Posted On 2017-07-14