Incidental Mutation 'R6061:Olfr569'
ID 483234
Institutional Source Beutler Lab
Gene Symbol Olfr569
Ensembl Gene ENSMUSG00000062142
Gene Name olfactory receptor 569
Synonyms MOR30-1, GA_x6K02T2PBJ9-5599295-5598351
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102883709-102890882 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 102887951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 67 (L67F)
Ref Sequence ENSEMBL: ENSMUSP00000149088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078191] [ENSMUST00000217024]
AlphaFold Q8VGZ2
Predicted Effect probably benign
Transcript: ENSMUST00000078191
AA Change: L67F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077321
Gene: ENSMUSG00000062142
AA Change: L67F

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.2e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 229 1.3e-9 PFAM
Pfam:7tm_1 43 294 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217024
AA Change: L67F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Olfr569
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr569 APN 7 102887607 missense probably damaging 1.00
IGL02505:Olfr569 APN 7 102887607 missense probably damaging 1.00
IGL02885:Olfr569 APN 7 102888036 missense possibly damaging 0.83
IGL03339:Olfr569 APN 7 102887782 missense probably benign 0.02
R0383:Olfr569 UTSW 7 102887251 missense possibly damaging 0.91
R1767:Olfr569 UTSW 7 102887626 missense probably damaging 1.00
R1793:Olfr569 UTSW 7 102888043 missense probably benign 0.44
R1812:Olfr569 UTSW 7 102888078 missense probably benign 0.32
R7855:Olfr569 UTSW 7 102887628 missense probably benign 0.01
R8155:Olfr569 UTSW 7 102887245 missense probably benign 0.00
R8890:Olfr569 UTSW 7 102887492 nonsense probably null
R9131:Olfr569 UTSW 7 102887979 missense probably benign 0.07
R9188:Olfr569 UTSW 7 102887389 missense possibly damaging 0.95
R9398:Olfr569 UTSW 7 102887793 missense probably damaging 1.00
Z1177:Olfr569 UTSW 7 102887761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGATGCTGGAATGTCGG -3'
(R):5'- TCAAGTAACAGCTCTTCCCATC -3'

Sequencing Primer
(F):5'- GCAGATAGCCACATAGCGGTC -3'
(R):5'- GTAACAGCTCTTCCCATCCCCTG -3'
Posted On 2017-07-14