Incidental Mutation 'R6061:Gm4353'
ID 483236
Institutional Source Beutler Lab
Gene Symbol Gm4353
Ensembl Gene ENSMUSG00000091900
Gene Name predicted gene 4353
Synonyms
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 116082863-116084635 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116084269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 97 (D97V)
Ref Sequence ENSEMBL: ENSMUSP00000107385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111755] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000111755
AA Change: D97V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107385
Gene: ENSMUSG00000091900
AA Change: D97V

DomainStartEndE-ValueType
Pfam:Nup35_RRM 166 251 8.2e-30 PFAM
Pfam:Nup35_RRM_2 172 224 9.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150518
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect probably benign
Transcript: ENSMUST00000205450
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Gm4353
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gm4353 APN 7 116083554 missense probably damaging 0.99
IGL01294:Gm4353 APN 7 116083842 missense possibly damaging 0.52
IGL01478:Gm4353 APN 7 116083740 missense possibly damaging 0.82
IGL02444:Gm4353 APN 7 116083444 missense probably benign 0.03
IGL02537:Gm4353 APN 7 116083752 missense probably damaging 1.00
R0501:Gm4353 UTSW 7 116083471 missense probably benign 0.33
R1853:Gm4353 UTSW 7 116083569 missense probably benign
R2061:Gm4353 UTSW 7 116083699 missense probably damaging 1.00
R4540:Gm4353 UTSW 7 116083977 missense probably benign 0.00
R4597:Gm4353 UTSW 7 116083612 nonsense probably null
R4873:Gm4353 UTSW 7 116084413 missense probably damaging 0.99
R4875:Gm4353 UTSW 7 116084413 missense probably damaging 0.99
R5668:Gm4353 UTSW 7 116083678 missense probably damaging 1.00
R5820:Gm4353 UTSW 7 116084458 missense possibly damaging 0.46
R6237:Gm4353 UTSW 7 116083899 missense possibly damaging 0.88
R7177:Gm4353 UTSW 7 116084492 missense probably damaging 1.00
R7354:Gm4353 UTSW 7 116083911 missense probably benign 0.01
R7777:Gm4353 UTSW 7 116083763 missense possibly damaging 0.96
R7971:Gm4353 UTSW 7 116083512 missense possibly damaging 0.64
R8236:Gm4353 UTSW 7 116083383 missense probably damaging 1.00
R8419:Gm4353 UTSW 7 116083549 missense probably benign 0.09
R8436:Gm4353 UTSW 7 116083629 missense probably damaging 1.00
R9109:Gm4353 UTSW 7 116083608 missense probably benign 0.00
R9226:Gm4353 UTSW 7 116083771 missense probably damaging 1.00
R9298:Gm4353 UTSW 7 116083608 missense probably benign 0.00
R9328:Gm4353 UTSW 7 116083489 missense probably damaging 1.00
R9433:Gm4353 UTSW 7 116083636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGACTAAACATGCTTTGCCC -3'
(R):5'- GATCTACCAGCTCCAGTGAC -3'

Sequencing Primer
(F):5'- TTGTAGCTCCAACAAGAGGACTCTG -3'
(R):5'- CTCCGCAACCTCGATCAATTAGTG -3'
Posted On 2017-07-14