Incidental Mutation 'R6061:Vps9d1'
ID 483238
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene Name VPS9 domain containing 1
Synonyms 2410004N05Rik, 1300018I17Rik
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 123969095-123980961 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123972410 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 497 (M497K)
Ref Sequence ENSEMBL: ENSMUSP00000113634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869]
AlphaFold Q8C190
Predicted Effect probably damaging
Transcript: ENSMUST00000117643
AA Change: M497K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: M497K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118279
AA Change: M497K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: M497K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122363
AA Change: M497K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: M497K

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124508
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155853
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123,971,937 (GRCm39) missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123,972,769 (GRCm39) missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123,973,739 (GRCm39) missense probably damaging 1.00
R0568:Vps9d1 UTSW 8 123,973,487 (GRCm39) missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123,974,706 (GRCm39) missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123,973,778 (GRCm39) missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123,973,778 (GRCm39) missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123,979,404 (GRCm39) missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123,971,860 (GRCm39) missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123,974,976 (GRCm39) intron probably benign
R4458:Vps9d1 UTSW 8 123,974,487 (GRCm39) missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123,975,351 (GRCm39) critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123,971,853 (GRCm39) missense possibly damaging 0.89
R5392:Vps9d1 UTSW 8 123,980,752 (GRCm39) missense probably damaging 0.99
R5423:Vps9d1 UTSW 8 123,974,704 (GRCm39) critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123,974,487 (GRCm39) missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123,975,598 (GRCm39) missense probably damaging 1.00
R5695:Vps9d1 UTSW 8 123,973,655 (GRCm39) missense probably benign
R5908:Vps9d1 UTSW 8 123,973,563 (GRCm39) missense probably benign 0.28
R6250:Vps9d1 UTSW 8 123,974,947 (GRCm39) critical splice acceptor site probably null
R6416:Vps9d1 UTSW 8 123,975,378 (GRCm39) missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123,980,746 (GRCm39) missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123,973,882 (GRCm39) nonsense probably null
R7584:Vps9d1 UTSW 8 123,977,456 (GRCm39) missense probably damaging 1.00
R8321:Vps9d1 UTSW 8 123,975,544 (GRCm39) missense possibly damaging 0.47
R9178:Vps9d1 UTSW 8 123,975,574 (GRCm39) missense probably damaging 0.97
R9218:Vps9d1 UTSW 8 123,977,674 (GRCm39) missense probably benign 0.12
R9366:Vps9d1 UTSW 8 123,974,486 (GRCm39) nonsense probably null
R9542:Vps9d1 UTSW 8 123,970,522 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTTAGTGAGGGACCTGC -3'
(R):5'- CAAGTGTGCAGGTGGCTAAG -3'

Sequencing Primer
(F):5'- ACCTGCAGGCTAGCACAG -3'
(R):5'- GCTAAGCCACTTATCTGTCTAGAGAC -3'
Posted On 2017-07-14