Incidental Mutation 'R6061:Rab3d'
ID 483239
Institutional Source Beutler Lab
Gene Symbol Rab3d
Ensembl Gene ENSMUSG00000019066
Gene Name RAB3D, member RAS oncogene family
Synonyms
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21907491-21918192 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21910519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 209 (T209A)
Ref Sequence ENSEMBL: ENSMUSP00000113322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115351] [ENSMUST00000119055] [ENSMUST00000122211] [ENSMUST00000128442]
AlphaFold P35276
Predicted Effect probably benign
Transcript: ENSMUST00000115351
AA Change: T209A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111008
Gene: ENSMUSG00000019066
AA Change: T209A

DomainStartEndE-ValueType
RAB 23 186 1.23e-96 SMART
low complexity region 193 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119055
SMART Domains Protein: ENSMUSP00000114106
Gene: ENSMUSG00000019066

DomainStartEndE-ValueType
Pfam:Arf 14 130 3e-11 PFAM
Pfam:Gtr1_RagA 24 126 2.3e-7 PFAM
Pfam:Miro 24 128 2.2e-15 PFAM
Pfam:Ras 24 130 6.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122211
AA Change: T209A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113322
Gene: ENSMUSG00000019066
AA Change: T209A

DomainStartEndE-ValueType
RAB 23 186 1.23e-96 SMART
low complexity region 193 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128442
SMART Domains Protein: ENSMUSP00000120067
Gene: ENSMUSG00000019066

DomainStartEndE-ValueType
Pfam:Arf 14 106 1.5e-9 PFAM
Pfam:Gtr1_RagA 24 96 1.7e-6 PFAM
Pfam:Miro 24 106 1.4e-11 PFAM
Pfam:Ras 24 106 1.3e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show no obvious phenotypic changes. Secretory granules in mast cells and some exocrine glands are double in volume however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Rab3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Rab3d APN 9 21915724 missense probably damaging 1.00
R0054:Rab3d UTSW 9 21915926 missense possibly damaging 0.82
R0616:Rab3d UTSW 9 21914764 missense probably damaging 1.00
R0629:Rab3d UTSW 9 21914686 missense probably benign 0.00
R2437:Rab3d UTSW 9 21915851 missense probably damaging 1.00
R3687:Rab3d UTSW 9 21914908 missense probably damaging 1.00
R6062:Rab3d UTSW 9 21910519 missense probably benign
R6065:Rab3d UTSW 9 21910519 missense probably benign
R7962:Rab3d UTSW 9 21914933 missense probably damaging 1.00
R8966:Rab3d UTSW 9 21914764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACATGAACTTGTGCAAG -3'
(R):5'- ACTCCACTTTCTAGGCCCAG -3'

Sequencing Primer
(F):5'- CATGAACTTGTGCAAGAGGAGTG -3'
(R):5'- TTTGGGACTCACATGACCG -3'
Posted On 2017-07-14