Incidental Mutation 'R0518:Trim17'
ID48324
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Nametripartite motif-containing 17
Synonymsterf, Rnf16
MMRRC Submission 038711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0518 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58954685-58973098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58968494 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 178 (V178E)
Ref Sequence ENSEMBL: ENSMUSP00000037248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
Predicted Effect probably damaging
Transcript: ENSMUST00000047697
AA Change: V178E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: V178E

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075141
AA Change: V178E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: V178E

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131221
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Acaca A G 11: 84,290,286 probably null Het
Acsm5 T C 7: 119,535,800 V327A possibly damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Akr1c14 T C 13: 4,081,016 L236S probably damaging Het
Ammecr1l C T 18: 31,771,901 S65L probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Arhgef16 G T 4: 154,291,034 P168T probably damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Cacna1s C A 1: 136,076,859 D132E probably benign Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Coa3 T A 11: 101,278,890 K13M probably damaging Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crhbp C A 13: 95,443,895 probably null Het
Cryba2 T C 1: 74,890,125 Y153C possibly damaging Het
Cryzl2 T C 1: 157,464,430 V93A probably damaging Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Cyp2r1 T G 7: 114,552,900 H274P probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx58 C T 4: 40,216,354 probably null Het
Dnd1 A G 18: 36,764,043 V350A possibly damaging Het
Dsg1b A T 18: 20,388,164 Q26L probably benign Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Fam20b C A 1: 156,687,456 V280F possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hk3 C T 13: 55,014,426 probably null Het
Hsd3b7 A G 7: 127,803,079 T330A probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Kti12 T A 4: 108,848,579 V230E possibly damaging Het
Mgat5 T A 1: 127,384,847 I241N probably damaging Het
Mkln1 A G 6: 31,468,132 N321S probably benign Het
Mllt10 T G 2: 18,071,206 probably null Het
Ms4a1 C A 19: 11,258,679 probably null Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nipsnap3b T A 4: 53,021,343 F243I probably damaging Het
Ogfod1 T A 8: 94,055,248 probably null Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
P2ry14 T A 3: 59,115,204 E287D probably damaging Het
Pank4 A T 4: 154,976,625 R510S possibly damaging Het
Pcsk6 T A 7: 65,980,167 V347E possibly damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pik3c2b C A 1: 133,105,992 P1578H probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
Ppp1r26 A G 2: 28,452,302 D648G probably damaging Het
Ptprs A G 17: 56,419,621 probably null Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Ski A G 4: 155,159,286 probably null Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Slc25a36 A T 9: 97,097,175 I71N probably damaging Het
Syne2 A C 12: 76,108,862 probably null Het
Tdrd5 C A 1: 156,262,941 W845L probably damaging Het
Tfb2m T C 1: 179,537,824 I192V possibly damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tmem211 T A 5: 113,236,007 L97* probably null Het
Trank1 A C 9: 111,333,808 D45A probably damaging Het
Trim9 A T 12: 70,346,585 L195Q probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn1r4 G T 6: 56,956,898 C129F probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Wdr78 A C 4: 103,064,530 Y464* probably null Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCAAAAGTCTGGCTTCCCCAAC -3'
(R):5'- GGTTTGTGGCAACACAGAAAATCCC -3'

Sequencing Primer
(F):5'- GGCTTCCCCAACTTTTCCTAAG -3'
(R):5'- CTGCAACAGGATCAGGTCCAG -3'
Posted On2013-06-12