Incidental Mutation 'R6061:Glipr1l1'
ID483243
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene NameGLI pathogenesis-related 1 like 1
Synonyms1700011E04Rik
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6061 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location112060189-112078510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112076170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 203 (T203M)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
Predicted Effect probably benign
Transcript: ENSMUST00000073617
AA Change: T203M

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: T203M

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr138 A G 17: 38,274,881 M37V probably benign Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0987:Glipr1l1 UTSW 10 112078435 missense probably benign
R0992:Glipr1l1 UTSW 10 112062325 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5552:Glipr1l1 UTSW 10 112062338 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 112078390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCTACTAAAGAGCAGGCATTGC -3'
(R):5'- TGAGCACTACAGCAGACTAGATC -3'

Sequencing Primer
(F):5'- AAGCTTGCATAGACGTTG -3'
(R):5'- TACAGCAGACTAGATCACAGTTG -3'
Posted On2017-07-14