Incidental Mutation 'R6061:Olfr138'
ID 483250
Institutional Source Beutler Lab
Gene Symbol Olfr138
Ensembl Gene ENSMUSG00000057443
Gene Name olfactory receptor 138
Synonyms GA_x6K02T2PSCP-2718585-2719523, MOR256-40P, Olfr89
MMRRC Submission 044226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38261035-38276410 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38274881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 37 (M37V)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
AlphaFold Q7TRI7
Predicted Effect probably benign
Transcript: ENSMUST00000071871
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172843
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173841
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,568,712 F484C probably damaging Het
Cdsn A G 17: 35,554,906 S111G unknown Het
Ctnnal1 T C 4: 56,812,349 T726A probably benign Het
Cyp2j11 T A 4: 96,348,616 probably benign Het
Ddx60 T A 8: 62,023,241 M1541K probably null Het
Dnah14 C T 1: 181,709,051 P2420S probably damaging Het
Doxl2 A C 6: 48,976,601 I487L probably benign Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Glipr1l1 C T 10: 112,076,170 T203M probably benign Het
Gm4353 T A 7: 116,084,269 D97V probably benign Het
Gprc6a A T 10: 51,615,811 I543K probably damaging Het
Ifi205 T C 1: 174,027,264 T110A possibly damaging Het
Med27 T A 2: 29,509,441 S95T probably damaging Het
Mocs1 T C 17: 49,450,313 S308P probably damaging Het
Mrpl11 C T 19: 4,963,369 S88F possibly damaging Het
Nav3 A T 10: 109,866,984 Y229* probably null Het
Olfr38 A T 6: 42,762,965 L304F probably damaging Het
Olfr569 C A 7: 102,887,951 L67F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Olfr996 T A 2: 85,579,542 M101K possibly damaging Het
Pear1 A G 3: 87,755,931 I460T probably benign Het
Phc3 T A 3: 30,914,529 K816N probably damaging Het
Phf19 T A 2: 34,897,117 D445V probably damaging Het
Pkd2l2 T C 18: 34,430,689 F486L probably damaging Het
Plagl1 G T 10: 13,127,895 probably benign Het
Prkca A G 11: 108,057,845 I106T probably benign Het
Ptpn3 C T 4: 57,248,681 G218R probably damaging Het
Ptx3 A G 3: 66,224,709 D217G possibly damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rfx2 A G 17: 56,777,473 F642S possibly damaging Het
Rhpn2 T A 7: 35,376,211 M271K possibly damaging Het
Serpinb6b A G 13: 32,977,994 T259A probably damaging Het
Speer3 G A 5: 13,794,691 V123M possibly damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Thbs4 A G 13: 92,751,795 F950L probably benign Het
Tiparp T C 3: 65,553,243 V551A probably damaging Het
Vmn2r71 T A 7: 85,619,274 D228E probably benign Het
Vmn2r85 T C 10: 130,425,662 I269V probably benign Het
Vps9d1 A T 8: 123,245,671 M497K probably damaging Het
Wnt5b A G 6: 119,433,642 V241A probably damaging Het
Xdh T C 17: 73,921,347 N353S probably damaging Het
Zfp526 C T 7: 25,226,332 T672M probably damaging Het
Other mutations in Olfr138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Olfr138 APN 17 38274899 missense probably benign 0.01
IGL01874:Olfr138 APN 17 38275517 missense probably benign 0.32
IGL02209:Olfr138 APN 17 38275232 missense probably benign 0.00
IGL03053:Olfr138 APN 17 38274791 missense probably damaging 0.96
IGL03168:Olfr138 APN 17 38274791 missense probably damaging 0.96
R0393:Olfr138 UTSW 17 38274883 missense probably benign 0.00
R0667:Olfr138 UTSW 17 38275157 missense probably damaging 1.00
R1288:Olfr138 UTSW 17 38275223 missense probably benign 0.09
R1567:Olfr138 UTSW 17 38275568 missense possibly damaging 0.87
R1618:Olfr138 UTSW 17 38275666 splice site probably null
R1699:Olfr138 UTSW 17 38275041 missense probably benign 0.39
R1748:Olfr138 UTSW 17 38275106 missense possibly damaging 0.50
R1862:Olfr138 UTSW 17 38275344 missense probably damaging 0.99
R2251:Olfr138 UTSW 17 38274903 missense probably benign 0.01
R3436:Olfr138 UTSW 17 38275530 missense probably damaging 1.00
R4731:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4732:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4733:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R5404:Olfr138 UTSW 17 38275626 nonsense probably null
R5443:Olfr138 UTSW 17 38275014 missense probably damaging 0.99
R5683:Olfr138 UTSW 17 38275546 missense possibly damaging 0.69
R6058:Olfr138 UTSW 17 38275259 missense probably damaging 0.99
R6266:Olfr138 UTSW 17 38275148 missense probably benign 0.22
R7520:Olfr138 UTSW 17 38275440 missense probably benign 0.00
R7717:Olfr138 UTSW 17 38275580 missense probably damaging 1.00
R7959:Olfr138 UTSW 17 38275711 makesense probably null
R8256:Olfr138 UTSW 17 38275520 missense probably damaging 0.99
R9241:Olfr138 UTSW 17 38274890 missense probably benign 0.00
R9509:Olfr138 UTSW 17 38275390 missense probably benign 0.01
X0024:Olfr138 UTSW 17 38275445 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTACAGCATGCCATACTCTTGG -3'
(R):5'- AGACATTCTGTGCCTCCCATTATG -3'

Sequencing Primer
(F):5'- AAGCACTGTGTAATCTCTCCAG -3'
(R):5'- GTTGAACAACACATCCAATGTAAG -3'
Posted On 2017-07-14