Incidental Mutation 'R6061:Or2n1e'
ID 483250
Institutional Source Beutler Lab
Gene Symbol Or2n1e
Ensembl Gene ENSMUSG00000057443
Gene Name olfactory receptor family 2 subfamily N member 1E
Synonyms MOR256-40P, Olfr138, Olfr89, GA_x6K02T2PSCP-2718585-2719523
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6061 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38585664-38586602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38585772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 37 (M37V)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
AlphaFold Q7TRI7
Predicted Effect probably benign
Transcript: ENSMUST00000071871
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172843
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173841
AA Change: M37V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: M37V

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Or2n1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Or2n1e APN 17 38,585,790 (GRCm39) missense probably benign 0.01
IGL01874:Or2n1e APN 17 38,586,408 (GRCm39) missense probably benign 0.32
IGL02209:Or2n1e APN 17 38,586,123 (GRCm39) missense probably benign 0.00
IGL03053:Or2n1e APN 17 38,585,682 (GRCm39) missense probably damaging 0.96
IGL03168:Or2n1e APN 17 38,585,682 (GRCm39) missense probably damaging 0.96
R0393:Or2n1e UTSW 17 38,585,774 (GRCm39) missense probably benign 0.00
R0667:Or2n1e UTSW 17 38,586,048 (GRCm39) missense probably damaging 1.00
R1288:Or2n1e UTSW 17 38,586,114 (GRCm39) missense probably benign 0.09
R1567:Or2n1e UTSW 17 38,586,459 (GRCm39) missense possibly damaging 0.87
R1618:Or2n1e UTSW 17 38,586,557 (GRCm39) splice site probably null
R1699:Or2n1e UTSW 17 38,585,932 (GRCm39) missense probably benign 0.39
R1748:Or2n1e UTSW 17 38,585,997 (GRCm39) missense possibly damaging 0.50
R1862:Or2n1e UTSW 17 38,586,235 (GRCm39) missense probably damaging 0.99
R2251:Or2n1e UTSW 17 38,585,794 (GRCm39) missense probably benign 0.01
R3436:Or2n1e UTSW 17 38,586,421 (GRCm39) missense probably damaging 1.00
R4731:Or2n1e UTSW 17 38,586,438 (GRCm39) missense probably damaging 1.00
R4732:Or2n1e UTSW 17 38,586,438 (GRCm39) missense probably damaging 1.00
R4733:Or2n1e UTSW 17 38,586,438 (GRCm39) missense probably damaging 1.00
R5404:Or2n1e UTSW 17 38,586,517 (GRCm39) nonsense probably null
R5443:Or2n1e UTSW 17 38,585,905 (GRCm39) missense probably damaging 0.99
R5683:Or2n1e UTSW 17 38,586,437 (GRCm39) missense possibly damaging 0.69
R6058:Or2n1e UTSW 17 38,586,150 (GRCm39) missense probably damaging 0.99
R6266:Or2n1e UTSW 17 38,586,039 (GRCm39) missense probably benign 0.22
R7520:Or2n1e UTSW 17 38,586,331 (GRCm39) missense probably benign 0.00
R7717:Or2n1e UTSW 17 38,586,471 (GRCm39) missense probably damaging 1.00
R7959:Or2n1e UTSW 17 38,586,602 (GRCm39) makesense probably null
R8256:Or2n1e UTSW 17 38,586,411 (GRCm39) missense probably damaging 0.99
R9241:Or2n1e UTSW 17 38,585,781 (GRCm39) missense probably benign 0.00
R9509:Or2n1e UTSW 17 38,586,281 (GRCm39) missense probably benign 0.01
X0024:Or2n1e UTSW 17 38,586,336 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTACAGCATGCCATACTCTTGG -3'
(R):5'- AGACATTCTGTGCCTCCCATTATG -3'

Sequencing Primer
(F):5'- AAGCACTGTGTAATCTCTCCAG -3'
(R):5'- GTTGAACAACACATCCAATGTAAG -3'
Posted On 2017-07-14