Mutagenetix > Incidental Mutation

Incidental Mutation 'R6061:Rfx2'

483252

Institutional Source

Beutler Lab

Gene Symbol

Rfx2

Ensembl Gene

ENSMUSG00000024206

Gene Name

regulatory factor X, 2 (influences HLA class II expression)

Synonyms

5430432H19Rik

MMRRC Submission

044226-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R6061 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56775897-56831008 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56777473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 642 (F642S)

Ref Sequence

ENSEMBL: ENSMUSP00000084010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000086801]

AlphaFold

P48379

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002444
AA Change: F667S

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206
AA Change: F667S

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	4	149	1.9e-50	PFAM
Pfam:RFX_DNA_binding	192	269	4.3e-36	PFAM
Blast:HisKA	479	542	1e-31	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086801
AA Change: F642S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206
AA Change: F642S

Domain	Start	End	E-Value	Type
Pfam:RFX1_trans_act	1	151	6.8e-56	PFAM
Pfam:RFX_DNA_binding	161	246	6e-41	PFAM
Blast:HisKA	454	517	1e-31	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene. Two transcript variants encoding different isoforms have been described for this gene, and both variants utilize alternative polyadenylation sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and lack an obvious embryonic phenotype but exhibit male infertility associated with a defect in spermatid maturation at or before the round and elongating spermatid stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	C	6: 128,568,712	F484C	probably damaging	Het
Cdsn	A	G	17: 35,554,906	S111G	unknown	Het
Ctnnal1	T	C	4: 56,812,349	T726A	probably benign	Het
Cyp2j11	T	A	4: 96,348,616		probably benign	Het
Ddx60	T	A	8: 62,023,241	M1541K	probably null	Het
Dnah14	C	T	1: 181,709,051	P2420S	probably damaging	Het
Doxl2	A	C	6: 48,976,601	I487L	probably benign	Het
Fhit	T	C	14: 9,573,435	E205G	probably benign	Het
Glipr1l1	C	T	10: 112,076,170	T203M	probably benign	Het
Gm4353	T	A	7: 116,084,269	D97V	probably benign	Het
Gprc6a	A	T	10: 51,615,811	I543K	probably damaging	Het
Ifi205	T	C	1: 174,027,264	T110A	possibly damaging	Het
Med27	T	A	2: 29,509,441	S95T	probably damaging	Het
Mocs1	T	C	17: 49,450,313	S308P	probably damaging	Het
Mrpl11	C	T	19: 4,963,369	S88F	possibly damaging	Het
Nav3	A	T	10: 109,866,984	Y229*	probably null	Het
Olfr138	A	G	17: 38,274,881	M37V	probably benign	Het
Olfr38	A	T	6: 42,762,965	L304F	probably damaging	Het
Olfr569	C	A	7: 102,887,951	L67F	probably benign	Het
Olfr668	C	T	7: 104,925,392	R124H	probably benign	Het
Olfr996	T	A	2: 85,579,542	M101K	possibly damaging	Het
Pear1	A	G	3: 87,755,931	I460T	probably benign	Het
Phc3	T	A	3: 30,914,529	K816N	probably damaging	Het
Phf19	T	A	2: 34,897,117	D445V	probably damaging	Het
Pkd2l2	T	C	18: 34,430,689	F486L	probably damaging	Het
Plagl1	G	T	10: 13,127,895		probably benign	Het
Prkca	A	G	11: 108,057,845	I106T	probably benign	Het
Ptpn3	C	T	4: 57,248,681	G218R	probably damaging	Het
Ptx3	A	G	3: 66,224,709	D217G	possibly damaging	Het
Rab3d	T	C	9: 21,910,519	T209A	probably benign	Het
Rhpn2	T	A	7: 35,376,211	M271K	possibly damaging	Het
Serpinb6b	A	G	13: 32,977,994	T259A	probably damaging	Het
Speer3	G	A	5: 13,794,691	V123M	possibly damaging	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Thbs4	A	G	13: 92,751,795	F950L	probably benign	Het
Tiparp	T	C	3: 65,553,243	V551A	probably damaging	Het
Vmn2r71	T	A	7: 85,619,274	D228E	probably benign	Het
Vmn2r85	T	C	10: 130,425,662	I269V	probably benign	Het
Vps9d1	A	T	8: 123,245,671	M497K	probably damaging	Het
Wnt5b	A	G	6: 119,433,642	V241A	probably damaging	Het
Xdh	T	C	17: 73,921,347	N353S	probably damaging	Het
Zfp526	C	T	7: 25,226,332	T672M	probably damaging	Het

Other mutations in Rfx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Rfx2	APN	17	56783657	missense	probably damaging	1.00
IGL01296:Rfx2	APN	17	56808317	start codon destroyed	possibly damaging	0.81
IGL01488:Rfx2	APN	17	56805398	missense	probably damaging	1.00
IGL01705:Rfx2	APN	17	56785303	missense	possibly damaging	0.88
IGL02389:Rfx2	APN	17	56808325	splice site	probably benign
IGL02601:Rfx2	APN	17	56785354	missense	possibly damaging	0.75
IGL02609:Rfx2	APN	17	56805404	missense	probably benign	0.00
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0066:Rfx2	UTSW	17	56786736	splice site	probably benign
R0197:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R0370:Rfx2	UTSW	17	56799308	missense	probably benign	0.03
R0413:Rfx2	UTSW	17	56784418	splice site	probably benign
R0622:Rfx2	UTSW	17	56777071	missense	probably damaging	0.99
R0883:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R1429:Rfx2	UTSW	17	56804369	missense	probably damaging	0.97
R1439:Rfx2	UTSW	17	56787720	missense	probably damaging	1.00
R1569:Rfx2	UTSW	17	56804326	missense	possibly damaging	0.63
R1654:Rfx2	UTSW	17	56808263	missense	probably benign	0.00
R1751:Rfx2	UTSW	17	56784754	missense	probably benign	0.01
R1816:Rfx2	UTSW	17	56808305	nonsense	probably null
R2282:Rfx2	UTSW	17	56803722	missense	probably damaging	0.99
R3408:Rfx2	UTSW	17	56803526	missense	probably benign	0.00
R3962:Rfx2	UTSW	17	56785302	missense	probably damaging	0.99
R4415:Rfx2	UTSW	17	56787733	missense	possibly damaging	0.95
R4876:Rfx2	UTSW	17	56784706	missense	probably benign	0.00
R4883:Rfx2	UTSW	17	56783747	missense	probably damaging	0.98
R5588:Rfx2	UTSW	17	56779890	missense	possibly damaging	0.69
R5766:Rfx2	UTSW	17	56803587	missense	probably benign	0.02
R5798:Rfx2	UTSW	17	56804362	missense	possibly damaging	0.89
R5931:Rfx2	UTSW	17	56780778	missense	probably damaging	0.99
R6466:Rfx2	UTSW	17	56784397	missense	probably benign	0.13
R6800:Rfx2	UTSW	17	56780804	missense	probably damaging	0.99
R7329:Rfx2	UTSW	17	56803681	missense	probably benign	0.05
R7476:Rfx2	UTSW	17	56803527	missense	probably benign	0.31
R8159:Rfx2	UTSW	17	56803605	missense	probably benign	0.43
R8274:Rfx2	UTSW	17	56804348	missense	probably benign	0.00
R8838:Rfx2	UTSW	17	56780877	missense	possibly damaging	0.91
R8964:Rfx2	UTSW	17	56786696	missense	probably damaging	1.00
R9663:Rfx2	UTSW	17	56780895	missense	possibly damaging	0.67
R9786:Rfx2	UTSW	17	56780890	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AGACTGGCCAGTGATAATCTCTC -3'
(R):5'- ACTGAAGCCACAGGAAGACT -3'

Sequencing Primer
(F):5'- GTTAAGCTACCACAGGATGTCACTG -3'
(R):5'- ACAGGAAGACTCGTGCTCTGTG -3'

Posted On

2017-07-14