Incidental Mutation 'R6061:Svil'
ID 483254
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Name supervillin
Synonyms B430302E16Rik
MMRRC Submission 044226-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R6061 (G1)
Quality Score 222.009
Status Not validated
Chromosome 18
Chromosomal Location 4920540-5119299 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 5106724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 1855 (V1855G)
Ref Sequence ENSEMBL: ENSMUSP00000122242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000210707] [ENSMUST00000143254]
AlphaFold Q8K4L3
Predicted Effect probably damaging
Transcript: ENSMUST00000025079
AA Change: V1855G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: V1855G

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125512
SMART Domains Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

DomainStartEndE-ValueType
low complexity region 168 178 N/A INTRINSIC
GEL 384 483 4.58e-22 SMART
GEL 508 625 4.03e-1 SMART
Blast:GEL 695 733 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126977
AA Change: V1855G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: V1855G

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127297
AA Change: V1741G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: V1741G

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131609
AA Change: V1855G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: V1855G

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140448
AA Change: V1855G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: V1855G

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210707
AA Change: V1942G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000143254
AA Change: V1451G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: V1451G

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146723
SMART Domains Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236

DomainStartEndE-ValueType
Blast:GEL 2 37 1e-17 BLAST
SCOP:d1d0na6 53 168 3e-19 SMART
Blast:GEL 63 169 1e-72 BLAST
Meta Mutation Damage Score 0.3171 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,545,675 (GRCm39) F484C probably damaging Het
Aoc1l1 A C 6: 48,953,535 (GRCm39) I487L probably benign Het
Cdsn A G 17: 35,865,803 (GRCm39) S111G unknown Het
Ctnnal1 T C 4: 56,812,349 (GRCm39) T726A probably benign Het
Cyp2j11 T A 4: 96,236,853 (GRCm39) probably benign Het
Ddx60 T A 8: 62,476,275 (GRCm39) M1541K probably null Het
Dnah14 C T 1: 181,536,616 (GRCm39) P2420S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Glipr1l1 C T 10: 111,912,075 (GRCm39) T203M probably benign Het
Gm4353 T A 7: 115,683,504 (GRCm39) D97V probably benign Het
Gprc6a A T 10: 51,491,907 (GRCm39) I543K probably damaging Het
Ifi205 T C 1: 173,854,830 (GRCm39) T110A possibly damaging Het
Med27 T A 2: 29,399,453 (GRCm39) S95T probably damaging Het
Mocs1 T C 17: 49,757,341 (GRCm39) S308P probably damaging Het
Mrpl11 C T 19: 5,013,397 (GRCm39) S88F possibly damaging Het
Nav3 A T 10: 109,702,845 (GRCm39) Y229* probably null Het
Or2f1b A T 6: 42,739,899 (GRCm39) L304F probably damaging Het
Or2n1e A G 17: 38,585,772 (GRCm39) M37V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or52r1 C A 7: 102,537,158 (GRCm39) L67F probably benign Het
Or5g27 T A 2: 85,409,886 (GRCm39) M101K possibly damaging Het
Pear1 A G 3: 87,663,238 (GRCm39) I460T probably benign Het
Phc3 T A 3: 30,968,678 (GRCm39) K816N probably damaging Het
Phf19 T A 2: 34,787,129 (GRCm39) D445V probably damaging Het
Pkd2l2 T C 18: 34,563,742 (GRCm39) F486L probably damaging Het
Plagl1 G T 10: 13,003,639 (GRCm39) probably benign Het
Prkca A G 11: 107,948,671 (GRCm39) I106T probably benign Het
Ptpn3 C T 4: 57,248,681 (GRCm39) G218R probably damaging Het
Ptx3 A G 3: 66,132,130 (GRCm39) D217G possibly damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rfx2 A G 17: 57,084,473 (GRCm39) F642S possibly damaging Het
Rhpn2 T A 7: 35,075,636 (GRCm39) M271K possibly damaging Het
Serpinb6b A G 13: 33,161,977 (GRCm39) T259A probably damaging Het
Speer3 G A 5: 13,844,705 (GRCm39) V123M possibly damaging Het
Thbs4 A G 13: 92,888,303 (GRCm39) F950L probably benign Het
Tiparp T C 3: 65,460,664 (GRCm39) V551A probably damaging Het
Vmn2r71 T A 7: 85,268,482 (GRCm39) D228E probably benign Het
Vmn2r85 T C 10: 130,261,531 (GRCm39) I269V probably benign Het
Vps9d1 A T 8: 123,972,410 (GRCm39) M497K probably damaging Het
Wnt5b A G 6: 119,410,603 (GRCm39) V241A probably damaging Het
Xdh T C 17: 74,228,342 (GRCm39) N353S probably damaging Het
Zfp526 C T 7: 24,925,757 (GRCm39) T672M probably damaging Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5,099,045 (GRCm39) missense probably benign 0.27
IGL00840:Svil APN 18 5,063,555 (GRCm39) missense probably benign
IGL01329:Svil APN 18 5,064,501 (GRCm39) missense probably benign
IGL01446:Svil APN 18 5,062,385 (GRCm39) missense probably damaging 1.00
IGL02068:Svil APN 18 5,092,899 (GRCm39) missense probably damaging 1.00
IGL02223:Svil APN 18 5,105,879 (GRCm39) splice site probably benign
IGL02428:Svil APN 18 5,118,203 (GRCm39) missense probably damaging 1.00
IGL02429:Svil APN 18 5,118,369 (GRCm39) missense probably benign 0.00
IGL02479:Svil APN 18 5,099,476 (GRCm39) missense probably damaging 1.00
IGL02560:Svil APN 18 5,049,379 (GRCm39) missense probably benign 0.00
IGL02652:Svil APN 18 5,114,531 (GRCm39) missense probably damaging 1.00
IGL03291:Svil APN 18 5,056,150 (GRCm39) nonsense probably null
R3779_Svil_985 UTSW 18 5,090,855 (GRCm39) missense probably damaging 0.97
R5433_Svil_176 UTSW 18 5,059,294 (GRCm39) missense probably damaging 0.99
R6062_Svil_873 UTSW 18 5,106,724 (GRCm39) missense probably damaging 1.00
BB002:Svil UTSW 18 5,118,357 (GRCm39) missense probably benign 0.00
BB012:Svil UTSW 18 5,118,357 (GRCm39) missense probably benign 0.00
IGL03055:Svil UTSW 18 5,108,615 (GRCm39) missense probably damaging 1.00
R0029:Svil UTSW 18 5,063,286 (GRCm39) missense probably benign 0.14
R0029:Svil UTSW 18 5,063,286 (GRCm39) missense probably benign 0.14
R0266:Svil UTSW 18 5,099,063 (GRCm39) splice site probably benign
R0281:Svil UTSW 18 5,094,582 (GRCm39) missense probably damaging 1.00
R0442:Svil UTSW 18 5,046,870 (GRCm39) missense probably damaging 1.00
R0549:Svil UTSW 18 5,064,566 (GRCm39) missense possibly damaging 0.79
R0617:Svil UTSW 18 5,117,002 (GRCm39) missense probably damaging 1.00
R0801:Svil UTSW 18 5,099,443 (GRCm39) missense probably benign 0.00
R0894:Svil UTSW 18 5,097,494 (GRCm39) missense probably damaging 1.00
R1053:Svil UTSW 18 5,056,690 (GRCm39) missense probably benign 0.16
R1065:Svil UTSW 18 5,063,777 (GRCm39) splice site probably benign
R1080:Svil UTSW 18 5,058,147 (GRCm39) missense possibly damaging 0.79
R1199:Svil UTSW 18 5,059,217 (GRCm39) splice site probably benign
R1472:Svil UTSW 18 5,048,950 (GRCm39) missense probably benign 0.09
R1480:Svil UTSW 18 5,057,345 (GRCm39) missense probably damaging 1.00
R1544:Svil UTSW 18 5,046,817 (GRCm39) missense possibly damaging 0.93
R1626:Svil UTSW 18 5,117,099 (GRCm39) critical splice donor site probably null
R1691:Svil UTSW 18 5,056,336 (GRCm39) missense probably benign 0.06
R1812:Svil UTSW 18 5,097,545 (GRCm39) missense probably damaging 1.00
R1826:Svil UTSW 18 5,063,383 (GRCm39) missense probably benign 0.01
R1842:Svil UTSW 18 5,062,373 (GRCm39) missense probably damaging 1.00
R1884:Svil UTSW 18 5,094,640 (GRCm39) missense possibly damaging 0.94
R1945:Svil UTSW 18 5,117,059 (GRCm39) missense probably damaging 1.00
R2184:Svil UTSW 18 5,099,615 (GRCm39) missense probably damaging 1.00
R2184:Svil UTSW 18 5,099,534 (GRCm39) missense probably damaging 1.00
R2232:Svil UTSW 18 5,046,640 (GRCm39) start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5,060,613 (GRCm39) splice site probably null
R3076:Svil UTSW 18 5,116,055 (GRCm39) missense probably damaging 1.00
R3777:Svil UTSW 18 5,090,855 (GRCm39) missense probably damaging 0.97
R3779:Svil UTSW 18 5,090,855 (GRCm39) missense probably damaging 0.97
R3797:Svil UTSW 18 5,060,534 (GRCm39) missense probably benign 0.29
R4077:Svil UTSW 18 5,063,522 (GRCm39) missense probably benign 0.03
R4350:Svil UTSW 18 5,118,154 (GRCm39) missense probably damaging 1.00
R4379:Svil UTSW 18 5,046,909 (GRCm39) missense probably damaging 1.00
R4488:Svil UTSW 18 5,049,067 (GRCm39) missense probably damaging 1.00
R4777:Svil UTSW 18 5,088,813 (GRCm39) missense probably damaging 0.99
R4825:Svil UTSW 18 5,114,564 (GRCm39) missense probably damaging 1.00
R4921:Svil UTSW 18 5,108,631 (GRCm39) missense probably damaging 1.00
R4969:Svil UTSW 18 5,095,516 (GRCm39) missense probably damaging 1.00
R4975:Svil UTSW 18 5,054,025 (GRCm39) missense possibly damaging 0.61
R4990:Svil UTSW 18 5,056,810 (GRCm39) missense probably benign 0.05
R4991:Svil UTSW 18 5,056,810 (GRCm39) missense probably benign 0.05
R5061:Svil UTSW 18 5,048,954 (GRCm39) missense probably benign 0.02
R5271:Svil UTSW 18 5,062,329 (GRCm39) missense probably benign 0.45
R5362:Svil UTSW 18 5,057,345 (GRCm39) missense probably damaging 1.00
R5433:Svil UTSW 18 5,059,294 (GRCm39) missense probably damaging 0.99
R5677:Svil UTSW 18 5,046,823 (GRCm39) nonsense probably null
R5850:Svil UTSW 18 5,098,900 (GRCm39) splice site probably null
R5868:Svil UTSW 18 5,056,854 (GRCm39) splice site probably null
R5871:Svil UTSW 18 5,103,669 (GRCm39) splice site probably null
R5876:Svil UTSW 18 5,082,828 (GRCm39) missense probably damaging 1.00
R6062:Svil UTSW 18 5,106,724 (GRCm39) missense probably damaging 1.00
R6063:Svil UTSW 18 5,106,724 (GRCm39) missense probably damaging 1.00
R6065:Svil UTSW 18 5,106,724 (GRCm39) missense probably damaging 1.00
R6066:Svil UTSW 18 5,106,724 (GRCm39) missense probably damaging 1.00
R6114:Svil UTSW 18 5,108,639 (GRCm39) missense probably damaging 1.00
R6115:Svil UTSW 18 5,108,675 (GRCm39) missense probably damaging 0.99
R6117:Svil UTSW 18 5,116,016 (GRCm39) missense probably damaging 1.00
R6302:Svil UTSW 18 5,057,432 (GRCm39) missense probably benign 0.13
R6418:Svil UTSW 18 5,040,171 (GRCm39) missense probably benign 0.26
R6441:Svil UTSW 18 5,049,323 (GRCm39) missense probably benign
R6446:Svil UTSW 18 5,057,323 (GRCm39) missense probably benign 0.09
R6455:Svil UTSW 18 5,056,629 (GRCm39) missense possibly damaging 0.89
R6545:Svil UTSW 18 5,108,621 (GRCm39) missense probably benign 0.00
R6692:Svil UTSW 18 5,082,853 (GRCm39) missense probably damaging 1.00
R6730:Svil UTSW 18 5,049,311 (GRCm39) missense probably benign 0.17
R6763:Svil UTSW 18 5,056,437 (GRCm39) missense probably damaging 0.99
R6870:Svil UTSW 18 5,063,231 (GRCm39) missense possibly damaging 0.86
R6916:Svil UTSW 18 5,114,682 (GRCm39) utr 3 prime probably benign
R7134:Svil UTSW 18 5,116,080 (GRCm39) missense probably damaging 1.00
R7190:Svil UTSW 18 5,092,937 (GRCm39) missense probably benign 0.01
R7213:Svil UTSW 18 5,094,574 (GRCm39) missense probably damaging 0.99
R7249:Svil UTSW 18 5,062,247 (GRCm39) missense probably damaging 0.99
R7249:Svil UTSW 18 5,056,270 (GRCm39) missense probably benign 0.01
R7421:Svil UTSW 18 5,056,109 (GRCm39) missense probably benign 0.18
R7571:Svil UTSW 18 5,114,636 (GRCm39) missense probably damaging 1.00
R7574:Svil UTSW 18 5,095,188 (GRCm39) missense probably benign 0.16
R7645:Svil UTSW 18 5,099,663 (GRCm39) missense probably damaging 1.00
R7925:Svil UTSW 18 5,118,357 (GRCm39) missense probably benign 0.00
R8113:Svil UTSW 18 5,062,385 (GRCm39) missense probably damaging 1.00
R8263:Svil UTSW 18 5,108,679 (GRCm39) missense probably damaging 1.00
R8485:Svil UTSW 18 5,064,566 (GRCm39) missense probably benign 0.03
R8491:Svil UTSW 18 5,106,678 (GRCm39) missense probably damaging 1.00
R8752:Svil UTSW 18 5,060,366 (GRCm39) intron probably benign
R8774:Svil UTSW 18 5,049,068 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Svil UTSW 18 5,049,068 (GRCm39) missense probably damaging 1.00
R8780:Svil UTSW 18 5,063,449 (GRCm39) missense probably benign 0.00
R8787:Svil UTSW 18 5,059,332 (GRCm39) nonsense probably null
R8790:Svil UTSW 18 5,056,098 (GRCm39) missense possibly damaging 0.82
R8974:Svil UTSW 18 5,099,650 (GRCm39) missense probably damaging 1.00
R9029:Svil UTSW 18 5,056,239 (GRCm39) missense probably benign
R9072:Svil UTSW 18 5,097,500 (GRCm39) missense probably benign 0.23
R9073:Svil UTSW 18 5,097,500 (GRCm39) missense probably benign 0.23
R9079:Svil UTSW 18 5,056,308 (GRCm39) missense probably benign 0.31
R9181:Svil UTSW 18 5,090,833 (GRCm39) missense possibly damaging 0.75
R9363:Svil UTSW 18 5,037,155 (GRCm39) missense probably benign 0.02
R9377:Svil UTSW 18 5,057,294 (GRCm39) missense probably benign 0.06
R9381:Svil UTSW 18 5,099,013 (GRCm39) missense probably benign 0.06
R9389:Svil UTSW 18 5,090,811 (GRCm39) missense possibly damaging 0.52
R9566:Svil UTSW 18 5,099,661 (GRCm39) missense probably damaging 1.00
R9607:Svil UTSW 18 5,058,126 (GRCm39) missense possibly damaging 0.92
R9716:Svil UTSW 18 5,062,370 (GRCm39) missense probably damaging 1.00
R9801:Svil UTSW 18 5,049,062 (GRCm39) missense probably damaging 1.00
X0065:Svil UTSW 18 5,062,317 (GRCm39) missense probably damaging 1.00
Z1177:Svil UTSW 18 5,062,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTGCAATCCCTACAAC -3'
(R):5'- CCTGGAGTCACTTTAAATATATGGGG -3'

Sequencing Primer
(F):5'- CATATGTCTTTGACAGCACACAGGG -3'
(R):5'- CCTTCTGGGATCCGCTTGG -3'
Posted On 2017-07-14