Incidental Mutation 'R6046:Mixl1'
ID483260
Institutional Source Beutler Lab
Gene Symbol Mixl1
Ensembl Gene ENSMUSG00000026497
Gene NameMix1 homeobox-like 1 (Xenopus laevis)
SynonymsMml
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6046 (G1)
Quality Score183.009
Status Validated
Chromosome1
Chromosomal Location180693043-180697034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180696771 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 81 (A81D)
Ref Sequence ENSEMBL: ENSMUSP00000027778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027778
AA Change: A81D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027778
Gene: ENSMUSG00000026497
AA Change: A81D

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
HOX 86 148 1.58e-24 SMART
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins, such as MIXL1, are transcription factors that regulate cell fate during development (Hart et al., 2005 [PubMed 15982639]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null embryos are mostly arrested in development by E9 exhibiting abnormalities in primitive streak and node formation, disorganized head folds, foreshortened body axis, absence of heart tube and gut, deficient paraxial mesoderm, abnormal notochord morphology, and an enlarged allantois. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Mixl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Mixl1 APN 1 180694704 missense probably benign 0.03
IGL03371:Mixl1 APN 1 180694626 missense probably benign 0.00
R0453:Mixl1 UTSW 1 180696646 missense probably damaging 1.00
R0838:Mixl1 UTSW 1 180696800 missense probably benign 0.45
R1832:Mixl1 UTSW 1 180694731 missense probably benign 0.11
R4870:Mixl1 UTSW 1 180694672 missense probably benign 0.06
R6918:Mixl1 UTSW 1 180694678 missense probably benign 0.02
R6980:Mixl1 UTSW 1 180696888 missense possibly damaging 0.51
R7047:Mixl1 UTSW 1 180696618 critical splice donor site probably null
R7296:Mixl1 UTSW 1 180696958 missense probably benign
X0065:Mixl1 UTSW 1 180694701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCCTGTGACTTCCCAG -3'
(R):5'- CAAAGCGGTTCGAGGTATGTGG -3'

Sequencing Primer
(F):5'- ACCTCCACTGGAACGCG -3'
(R):5'- TATAACTGCAGGCGCGC -3'
Posted On2017-07-14