Incidental Mutation 'R6046:Lrp2'
ID 483263
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms D230004K18Rik, b2b1625.2Clo, Megalin, Gp330
MMRRC Submission 044214-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6046 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69254679-69416373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69337098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1225 (T1225S)
Ref Sequence ENSEMBL: ENSMUSP00000097628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953] [ENSMUST00000100051]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080953
AA Change: T1225S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: T1225S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100051
AA Change: T1225S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097628
Gene: ENSMUSG00000027070
AA Change: T1225S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 6.18e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128742
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb3 T C 10: 85,223,947 (GRCm39) V252A unknown Het
Actn4 T C 7: 28,604,044 (GRCm39) I406V probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Ank1 T A 8: 23,606,114 (GRCm39) F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Atp9a C A 2: 168,476,790 (GRCm39) V1000L probably benign Het
Bnip3 A G 7: 138,511,033 (GRCm39) probably benign Het
Btnl6 T A 17: 34,727,371 (GRCm39) R386S probably damaging Het
Calcrl A G 2: 84,205,658 (GRCm39) V11A probably benign Het
Cc2d1a G T 8: 84,863,571 (GRCm39) A597D possibly damaging Het
Celsr3 A G 9: 108,714,350 (GRCm39) T1960A probably benign Het
Cfb T A 17: 35,081,078 (GRCm39) probably null Het
Chd8 A G 14: 52,458,528 (GRCm39) I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 (GRCm39) probably null Het
Crhr2 T A 6: 55,068,277 (GRCm39) T428S probably damaging Het
Crybg2 A T 4: 133,819,388 (GRCm39) I1753F probably damaging Het
Ctsq A T 13: 61,186,955 (GRCm39) V46E probably benign Het
Cxcr1 T C 1: 74,231,440 (GRCm39) E194G probably damaging Het
Dop1a A T 9: 86,397,396 (GRCm39) H900L probably damaging Het
Dpyd T A 3: 119,225,224 (GRCm39) M999K probably benign Het
Gbp3 A C 3: 142,273,560 (GRCm39) D369A possibly damaging Het
Glmp A G 3: 88,232,495 (GRCm39) E36G probably damaging Het
Gm10113 T C 13: 46,330,919 (GRCm39) noncoding transcript Het
Gm6486 T A 5: 3,120,846 (GRCm39) noncoding transcript Het
Gm973 T G 1: 59,671,509 (GRCm39) L891R unknown Het
Heatr3 C T 8: 88,866,582 (GRCm39) T8M probably damaging Het
Herc1 A G 9: 66,352,831 (GRCm39) M2106V probably damaging Het
Hfm1 A T 5: 107,046,509 (GRCm39) probably null Het
Hspa14 A G 2: 3,490,801 (GRCm39) V462A possibly damaging Het
Hspa5 C A 2: 34,665,761 (GRCm39) T535K possibly damaging Het
Ift140 A G 17: 25,274,563 (GRCm39) D745G probably benign Het
Ift27 A T 15: 78,057,981 (GRCm39) C8S possibly damaging Het
Irak1bp1 G A 9: 82,728,616 (GRCm39) W182* probably null Het
Itga3 A G 11: 94,953,541 (GRCm39) I236T probably benign Het
Kctd15 T A 7: 34,349,547 (GRCm39) N26Y possibly damaging Het
Kdm1b T C 13: 47,232,729 (GRCm39) V733A possibly damaging Het
Lhx8 A T 3: 154,027,340 (GRCm39) L234H probably damaging Het
Lrrn1 G A 6: 107,545,488 (GRCm39) D429N probably benign Het
Mettl3 A T 14: 52,536,243 (GRCm39) N200K possibly damaging Het
Mixl1 G T 1: 180,524,336 (GRCm39) A81D possibly damaging Het
Mroh2b T C 15: 4,980,763 (GRCm39) I1444T probably benign Het
Muc15 T A 2: 110,561,786 (GRCm39) L74* probably null Het
Olfm2 T A 9: 20,579,824 (GRCm39) Y317F probably damaging Het
Or52a33 C T 7: 103,288,886 (GRCm39) V154M probably benign Het
Or5b114-ps1 G A 19: 13,352,698 (GRCm39) S124N probably benign Het
Or5p54 T A 7: 107,554,001 (GRCm39) I51N probably benign Het
Pclo A T 5: 14,763,302 (GRCm39) Y3925F unknown Het
Pik3c2g A T 6: 139,599,137 (GRCm39) R84S probably damaging Het
Pik3c2g A G 6: 139,842,518 (GRCm39) Q449R probably damaging Het
Psg28 T C 7: 18,160,305 (GRCm39) E297G probably damaging Het
Qrich2 A T 11: 116,337,832 (GRCm39) probably benign Het
Rgs9 A G 11: 109,130,386 (GRCm39) I363T probably damaging Het
Rnpepl1 A G 1: 92,844,543 (GRCm39) D345G probably damaging Het
Rtn4 T A 11: 29,658,023 (GRCm39) F726I probably damaging Het
Sart3 A T 5: 113,893,507 (GRCm39) I330N probably damaging Het
Scn5a T C 9: 119,391,440 (GRCm39) D84G probably damaging Het
Sema4a T C 3: 88,348,008 (GRCm39) T438A probably damaging Het
Sfxn1 A C 13: 54,242,961 (GRCm39) Y73S probably benign Het
Slc24a2 A G 4: 86,914,882 (GRCm39) M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 (GRCm39) V656A probably benign Het
Smok2a T G 17: 13,445,021 (GRCm39) D199E probably benign Het
Tbc1d10c T C 19: 4,235,030 (GRCm39) I344V probably benign Het
Tll1 A T 8: 64,506,925 (GRCm39) Y605* probably null Het
Trim75 G A 8: 65,435,535 (GRCm39) P305L probably damaging Het
Unc13c T C 9: 73,838,166 (GRCm39) N895S probably benign Het
Vmn2r25 A T 6: 123,799,876 (GRCm39) I822N probably damaging Het
Wasf3 T G 5: 146,407,166 (GRCm39) D495E unknown Het
Wdhd1 T A 14: 47,510,667 (GRCm39) K119* probably null Het
Wnt2b T A 3: 104,858,339 (GRCm39) D310V probably damaging Het
Zfat G T 15: 68,052,626 (GRCm39) D389E probably damaging Het
Zfp282 G A 6: 47,857,102 (GRCm39) V112M probably damaging Het
Zfp617 A T 8: 72,687,257 (GRCm39) K529I probably damaging Het
Zfp866 A T 8: 70,218,373 (GRCm39) C416S probably damaging Het
Zfp991 G A 4: 147,264,222 (GRCm39) G533D probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,338,123 (GRCm39) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,316,624 (GRCm39) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,331,989 (GRCm39) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,289,860 (GRCm39) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,352,225 (GRCm39) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,299,780 (GRCm39) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,354,417 (GRCm39) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,322,776 (GRCm39) nonsense probably null
IGL01131:Lrp2 APN 2 69,329,583 (GRCm39) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,341,328 (GRCm39) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,333,870 (GRCm39) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,382,814 (GRCm39) splice site probably benign
IGL01375:Lrp2 APN 2 69,308,910 (GRCm39) splice site probably benign
IGL01384:Lrp2 APN 2 69,313,846 (GRCm39) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,284,156 (GRCm39) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,312,611 (GRCm39) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,355,630 (GRCm39) missense probably benign
IGL01444:Lrp2 APN 2 69,274,060 (GRCm39) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,302,783 (GRCm39) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,322,804 (GRCm39) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,259,050 (GRCm39) missense probably benign
IGL01761:Lrp2 APN 2 69,311,579 (GRCm39) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,316,528 (GRCm39) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,313,945 (GRCm39) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,357,922 (GRCm39) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,340,762 (GRCm39) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,367,960 (GRCm39) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,343,723 (GRCm39) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,297,224 (GRCm39) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,281,608 (GRCm39) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,365,390 (GRCm39) missense probably benign
IGL02248:Lrp2 APN 2 69,313,152 (GRCm39) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,294,980 (GRCm39) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,299,977 (GRCm39) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,291,649 (GRCm39) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,352,117 (GRCm39) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,295,145 (GRCm39) splice site probably benign
IGL02508:Lrp2 APN 2 69,333,774 (GRCm39) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,363,806 (GRCm39) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,337,080 (GRCm39) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,285,854 (GRCm39) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,318,181 (GRCm39) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,285,797 (GRCm39) splice site probably benign
IGL02990:Lrp2 APN 2 69,271,740 (GRCm39) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,367,897 (GRCm39) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,305,808 (GRCm39) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,313,477 (GRCm39) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,285,177 (GRCm39) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,307,370 (GRCm39) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,379,386 (GRCm39) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,285,796 (GRCm39) splice site probably benign
IGL03163:Lrp2 APN 2 69,331,870 (GRCm39) nonsense probably null
IGL03164:Lrp2 APN 2 69,295,043 (GRCm39) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,353,538 (GRCm39) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,296,609 (GRCm39) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,268,822 (GRCm39) splice site probably benign
IGL03288:Lrp2 APN 2 69,256,383 (GRCm39) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,268,797 (GRCm39) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,261,496 (GRCm39) missense probably damaging 1.00
casual UTSW 2 69,329,607 (GRCm39) missense probably benign
nonchalant UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
Presto UTSW 2 69,289,875 (GRCm39) nonsense probably null
relaxed UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
unguarded UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
Unintended UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,335,648 (GRCm39) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,288,792 (GRCm39) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,367,882 (GRCm39) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,305,747 (GRCm39) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,295,971 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,307,384 (GRCm39) missense probably benign
R0167:Lrp2 UTSW 2 69,256,002 (GRCm39) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,367,907 (GRCm39) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,258,974 (GRCm39) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,313,326 (GRCm39) splice site probably benign
R0323:Lrp2 UTSW 2 69,299,983 (GRCm39) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,365,387 (GRCm39) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,260,651 (GRCm39) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,290,681 (GRCm39) splice site probably benign
R0391:Lrp2 UTSW 2 69,287,202 (GRCm39) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,263,421 (GRCm39) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,309,492 (GRCm39) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,355,578 (GRCm39) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,338,145 (GRCm39) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,341,361 (GRCm39) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,258,998 (GRCm39) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,322,275 (GRCm39) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,367,982 (GRCm39) splice site probably benign
R0593:Lrp2 UTSW 2 69,297,350 (GRCm39) missense probably benign
R0608:Lrp2 UTSW 2 69,316,587 (GRCm39) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,278,464 (GRCm39) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,281,724 (GRCm39) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,341,292 (GRCm39) missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69,278,513 (GRCm39) missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69,338,334 (GRCm39) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,348,709 (GRCm39) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,312,697 (GRCm39) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,318,182 (GRCm39) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,354,380 (GRCm39) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,353,646 (GRCm39) splice site probably null
R1301:Lrp2 UTSW 2 69,258,948 (GRCm39) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,287,262 (GRCm39) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,313,738 (GRCm39) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,290,821 (GRCm39) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,353,526 (GRCm39) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,331,074 (GRCm39) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,332,954 (GRCm39) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,333,005 (GRCm39) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,297,107 (GRCm39) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,333,873 (GRCm39) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,340,762 (GRCm39) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,326,833 (GRCm39) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,333,874 (GRCm39) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,297,224 (GRCm39) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,353,631 (GRCm39) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,297,434 (GRCm39) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,338,187 (GRCm39) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,336,968 (GRCm39) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,313,729 (GRCm39) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,314,051 (GRCm39) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,341,411 (GRCm39) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,297,372 (GRCm39) missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69,341,354 (GRCm39) missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,322,191 (GRCm39) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,336,718 (GRCm39) splice site probably null
R2984:Lrp2 UTSW 2 69,256,158 (GRCm39) splice site probably null
R3085:Lrp2 UTSW 2 69,297,479 (GRCm39) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,262,328 (GRCm39) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,340,773 (GRCm39) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,326,680 (GRCm39) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,335,449 (GRCm39) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,339,548 (GRCm39) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,256,356 (GRCm39) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,367,909 (GRCm39) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,289,816 (GRCm39) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,379,391 (GRCm39) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,336,720 (GRCm39) missense probably benign
R4081:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,260,606 (GRCm39) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,297,487 (GRCm39) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,310,438 (GRCm39) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,256,335 (GRCm39) nonsense probably null
R4352:Lrp2 UTSW 2 69,262,526 (GRCm39) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,332,861 (GRCm39) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,297,513 (GRCm39) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,357,575 (GRCm39) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,336,692 (GRCm39) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,343,629 (GRCm39) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,366,419 (GRCm39) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,288,771 (GRCm39) nonsense probably null
R4622:Lrp2 UTSW 2 69,290,693 (GRCm39) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,319,473 (GRCm39) splice site probably null
R4633:Lrp2 UTSW 2 69,291,761 (GRCm39) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,297,337 (GRCm39) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,319,642 (GRCm39) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,336,895 (GRCm39) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,318,310 (GRCm39) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,311,517 (GRCm39) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4733:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4777:Lrp2 UTSW 2 69,312,608 (GRCm39) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,290,059 (GRCm39) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,368,300 (GRCm39) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,299,755 (GRCm39) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,339,585 (GRCm39) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,309,457 (GRCm39) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,302,712 (GRCm39) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,366,332 (GRCm39) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,311,732 (GRCm39) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,331,874 (GRCm39) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,319,502 (GRCm39) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,331,834 (GRCm39) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,260,686 (GRCm39) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,382,693 (GRCm39) splice site probably null
R5223:Lrp2 UTSW 2 69,354,397 (GRCm39) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,287,163 (GRCm39) splice site probably null
R5267:Lrp2 UTSW 2 69,379,322 (GRCm39) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,343,698 (GRCm39) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,355,572 (GRCm39) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,285,182 (GRCm39) nonsense probably null
R5356:Lrp2 UTSW 2 69,295,052 (GRCm39) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,289,904 (GRCm39) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,267,809 (GRCm39) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,382,768 (GRCm39) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,281,632 (GRCm39) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,294,968 (GRCm39) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,329,607 (GRCm39) missense probably benign
R5605:Lrp2 UTSW 2 69,353,643 (GRCm39) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,302,762 (GRCm39) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,350,258 (GRCm39) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,341,405 (GRCm39) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,332,897 (GRCm39) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,281,726 (GRCm39) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,339,491 (GRCm39) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,297,221 (GRCm39) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,285,869 (GRCm39) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,310,497 (GRCm39) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,273,120 (GRCm39) missense probably benign
R5951:Lrp2 UTSW 2 69,326,667 (GRCm39) splice site probably null
R5974:Lrp2 UTSW 2 69,289,892 (GRCm39) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,313,901 (GRCm39) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,341,345 (GRCm39) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,340,763 (GRCm39) frame shift probably null
R6180:Lrp2 UTSW 2 69,333,868 (GRCm39) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,299,822 (GRCm39) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,296,684 (GRCm39) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,267,025 (GRCm39) missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69,268,811 (GRCm39) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,313,787 (GRCm39) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,326,128 (GRCm39) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,291,631 (GRCm39) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,335,500 (GRCm39) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,339,647 (GRCm39) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,270,267 (GRCm39) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,299,749 (GRCm39) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,284,202 (GRCm39) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,314,124 (GRCm39) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,278,555 (GRCm39) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,314,248 (GRCm39) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,343,612 (GRCm39) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,343,721 (GRCm39) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,354,485 (GRCm39) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,340,846 (GRCm39) missense probably benign
R6902:Lrp2 UTSW 2 69,289,847 (GRCm39) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,302,709 (GRCm39) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,319,649 (GRCm39) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,302,799 (GRCm39) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,313,552 (GRCm39) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,313,372 (GRCm39) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,352,131 (GRCm39) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,296,089 (GRCm39) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,285,152 (GRCm39) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,318,395 (GRCm39) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,263,416 (GRCm39) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,302,877 (GRCm39) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,289,875 (GRCm39) nonsense probably null
R7278:Lrp2 UTSW 2 69,316,696 (GRCm39) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,312,725 (GRCm39) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,322,166 (GRCm39) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,309,634 (GRCm39) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,278,486 (GRCm39) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,302,741 (GRCm39) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,314,150 (GRCm39) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,331,036 (GRCm39) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,290,018 (GRCm39) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,262,557 (GRCm39) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,343,677 (GRCm39) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,367,925 (GRCm39) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,346,747 (GRCm39) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,307,352 (GRCm39) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,337,076 (GRCm39) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,319,581 (GRCm39) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,309,687 (GRCm39) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,326,782 (GRCm39) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,333,732 (GRCm39) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,295,128 (GRCm39) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,338,153 (GRCm39) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,338,154 (GRCm39) missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69,288,823 (GRCm39) missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69,271,710 (GRCm39) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,259,016 (GRCm39) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,268,732 (GRCm39) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,262,541 (GRCm39) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,333,867 (GRCm39) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,336,849 (GRCm39) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,339,713 (GRCm39) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,278,473 (GRCm39) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,295,089 (GRCm39) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,336,797 (GRCm39) missense probably benign
R8129:Lrp2 UTSW 2 69,260,624 (GRCm39) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,313,342 (GRCm39) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,311,611 (GRCm39) nonsense probably null
R8247:Lrp2 UTSW 2 69,261,431 (GRCm39) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,322,268 (GRCm39) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,346,828 (GRCm39) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8427:Lrp2 UTSW 2 69,281,641 (GRCm39) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,322,250 (GRCm39) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8529:Lrp2 UTSW 2 69,330,986 (GRCm39) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,302,804 (GRCm39) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,288,767 (GRCm39) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,278,583 (GRCm39) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,289,957 (GRCm39) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,274,138 (GRCm39) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,316,648 (GRCm39) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,382,745 (GRCm39) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,379,382 (GRCm39) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,341,348 (GRCm39) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,331,996 (GRCm39) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,350,260 (GRCm39) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,291,713 (GRCm39) nonsense probably null
R9173:Lrp2 UTSW 2 69,299,731 (GRCm39) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,333,891 (GRCm39) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,341,303 (GRCm39) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,310,379 (GRCm39) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,258,983 (GRCm39) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,357,979 (GRCm39) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,287,165 (GRCm39) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,261,497 (GRCm39) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,260,703 (GRCm39) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,289,928 (GRCm39) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,307,423 (GRCm39) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,339,549 (GRCm39) missense probably benign
X0011:Lrp2 UTSW 2 69,350,342 (GRCm39) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,266,944 (GRCm39) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,338,225 (GRCm39) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,310,386 (GRCm39) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,326,812 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,302,797 (GRCm39) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,281,624 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,339,633 (GRCm39) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,331,985 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACCCACGAGTTGTAGATG -3'
(R):5'- GCATAGCTTGTTGTTGGATCCAC -3'

Sequencing Primer
(F):5'- GCAGTTTCCATTGTCACAGAG -3'
(R):5'- GGATCCACTGATCTCCTGTAAATATG -3'
Posted On 2017-07-14