Incidental Mutation 'R6046:Lhx8'
ID483272
Institutional Source Beutler Lab
Gene Symbol Lhx8
Ensembl Gene ENSMUSG00000096225
Gene NameLIM homeobox protein 8
SynonymsL3, Lhx7
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location154306294-154330659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154321703 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 234 (L234H)
Ref Sequence ENSEMBL: ENSMUSP00000136047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177846] [ENSMUST00000204171] [ENSMUST00000204403] [ENSMUST00000205251]
Predicted Effect probably damaging
Transcript: ENSMUST00000177846
AA Change: L234H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136047
Gene: ENSMUSG00000096225
AA Change: L234H

DomainStartEndE-ValueType
low complexity region 67 87 N/A INTRINSIC
LIM 95 148 2.38e-12 SMART
LIM 156 210 2.06e-16 SMART
HOX 246 308 2.7e-23 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203692
Predicted Effect probably benign
Transcript: ENSMUST00000204171
SMART Domains Protein: ENSMUSP00000144708
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 11 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204403
SMART Domains Protein: ENSMUSP00000145516
Gene: ENSMUSG00000096225

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205251
AA Change: L203H

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145485
Gene: ENSMUSG00000096225
AA Change: L203H

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
LIM 64 117 2.38e-12 SMART
LIM 125 179 2.06e-16 SMART
HOX 215 277 2.7e-23 SMART
low complexity region 279 290 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice exhibit partial penetrance of a cleft secondary palate and neonatal lethality; those without cleft palate survive to adulthood. All homozygous null mice have decreased or absent forebrain cholinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Lhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Lhx8 APN 3 154322355 missense probably damaging 1.00
IGL01991:Lhx8 APN 3 154324554 missense probably damaging 1.00
R0463:Lhx8 UTSW 3 154328171 splice site probably null
R1449:Lhx8 UTSW 3 154328105 nonsense probably null
R1837:Lhx8 UTSW 3 154328055 missense possibly damaging 0.94
R2272:Lhx8 UTSW 3 154316762 missense probably damaging 1.00
R3196:Lhx8 UTSW 3 154330288 missense probably benign 0.05
R4900:Lhx8 UTSW 3 154330288 missense probably benign 0.01
R5120:Lhx8 UTSW 3 154311695 missense probably damaging 0.99
R5223:Lhx8 UTSW 3 154321644 missense probably damaging 1.00
R5587:Lhx8 UTSW 3 154311679 missense probably damaging 0.99
R7155:Lhx8 UTSW 3 154324584 missense possibly damaging 0.82
X0028:Lhx8 UTSW 3 154324575 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGTATTTTCAGGCAGCATGGAG -3'
(R):5'- AGATTGCACAAGGCTATAAGTACTG -3'

Sequencing Primer
(F):5'- CAGGCAGCATGGAGGTTGC -3'
(R):5'- GTAGAGACCCATCTGAGTTAC -3'
Posted On2017-07-14