Incidental Mutation 'R6046:Pik3c2g'
ID 483287
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 044214-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6046 (G1)
Quality Score 216.009
Status Validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139842518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 449 (Q449R)
Ref Sequence ENSEMBL: ENSMUSP00000084939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087657
AA Change: Q449R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: Q449R

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111868
AA Change: Q817R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Q817R

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189374
SMART Domains Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206646
AA Change: Q449R
Predicted Effect probably damaging
Transcript: ENSMUST00000218528
AA Change: Q699R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.4344 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb3 T C 10: 85,223,947 (GRCm39) V252A unknown Het
Actn4 T C 7: 28,604,044 (GRCm39) I406V probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Ank1 T A 8: 23,606,114 (GRCm39) F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Atp9a C A 2: 168,476,790 (GRCm39) V1000L probably benign Het
Bnip3 A G 7: 138,511,033 (GRCm39) probably benign Het
Btnl6 T A 17: 34,727,371 (GRCm39) R386S probably damaging Het
Calcrl A G 2: 84,205,658 (GRCm39) V11A probably benign Het
Cc2d1a G T 8: 84,863,571 (GRCm39) A597D possibly damaging Het
Celsr3 A G 9: 108,714,350 (GRCm39) T1960A probably benign Het
Cfb T A 17: 35,081,078 (GRCm39) probably null Het
Chd8 A G 14: 52,458,528 (GRCm39) I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 (GRCm39) probably null Het
Crhr2 T A 6: 55,068,277 (GRCm39) T428S probably damaging Het
Crybg2 A T 4: 133,819,388 (GRCm39) I1753F probably damaging Het
Ctsq A T 13: 61,186,955 (GRCm39) V46E probably benign Het
Cxcr1 T C 1: 74,231,440 (GRCm39) E194G probably damaging Het
Dop1a A T 9: 86,397,396 (GRCm39) H900L probably damaging Het
Dpyd T A 3: 119,225,224 (GRCm39) M999K probably benign Het
Gbp3 A C 3: 142,273,560 (GRCm39) D369A possibly damaging Het
Glmp A G 3: 88,232,495 (GRCm39) E36G probably damaging Het
Gm10113 T C 13: 46,330,919 (GRCm39) noncoding transcript Het
Gm6486 T A 5: 3,120,846 (GRCm39) noncoding transcript Het
Gm973 T G 1: 59,671,509 (GRCm39) L891R unknown Het
Heatr3 C T 8: 88,866,582 (GRCm39) T8M probably damaging Het
Herc1 A G 9: 66,352,831 (GRCm39) M2106V probably damaging Het
Hfm1 A T 5: 107,046,509 (GRCm39) probably null Het
Hspa14 A G 2: 3,490,801 (GRCm39) V462A possibly damaging Het
Hspa5 C A 2: 34,665,761 (GRCm39) T535K possibly damaging Het
Ift140 A G 17: 25,274,563 (GRCm39) D745G probably benign Het
Ift27 A T 15: 78,057,981 (GRCm39) C8S possibly damaging Het
Irak1bp1 G A 9: 82,728,616 (GRCm39) W182* probably null Het
Itga3 A G 11: 94,953,541 (GRCm39) I236T probably benign Het
Kctd15 T A 7: 34,349,547 (GRCm39) N26Y possibly damaging Het
Kdm1b T C 13: 47,232,729 (GRCm39) V733A possibly damaging Het
Lhx8 A T 3: 154,027,340 (GRCm39) L234H probably damaging Het
Lrp2 T A 2: 69,337,098 (GRCm39) T1225S probably damaging Het
Lrrn1 G A 6: 107,545,488 (GRCm39) D429N probably benign Het
Mettl3 A T 14: 52,536,243 (GRCm39) N200K possibly damaging Het
Mixl1 G T 1: 180,524,336 (GRCm39) A81D possibly damaging Het
Mroh2b T C 15: 4,980,763 (GRCm39) I1444T probably benign Het
Muc15 T A 2: 110,561,786 (GRCm39) L74* probably null Het
Olfm2 T A 9: 20,579,824 (GRCm39) Y317F probably damaging Het
Or52a33 C T 7: 103,288,886 (GRCm39) V154M probably benign Het
Or5b114-ps1 G A 19: 13,352,698 (GRCm39) S124N probably benign Het
Or5p54 T A 7: 107,554,001 (GRCm39) I51N probably benign Het
Pclo A T 5: 14,763,302 (GRCm39) Y3925F unknown Het
Psg28 T C 7: 18,160,305 (GRCm39) E297G probably damaging Het
Qrich2 A T 11: 116,337,832 (GRCm39) probably benign Het
Rgs9 A G 11: 109,130,386 (GRCm39) I363T probably damaging Het
Rnpepl1 A G 1: 92,844,543 (GRCm39) D345G probably damaging Het
Rtn4 T A 11: 29,658,023 (GRCm39) F726I probably damaging Het
Sart3 A T 5: 113,893,507 (GRCm39) I330N probably damaging Het
Scn5a T C 9: 119,391,440 (GRCm39) D84G probably damaging Het
Sema4a T C 3: 88,348,008 (GRCm39) T438A probably damaging Het
Sfxn1 A C 13: 54,242,961 (GRCm39) Y73S probably benign Het
Slc24a2 A G 4: 86,914,882 (GRCm39) M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 (GRCm39) V656A probably benign Het
Smok2a T G 17: 13,445,021 (GRCm39) D199E probably benign Het
Tbc1d10c T C 19: 4,235,030 (GRCm39) I344V probably benign Het
Tll1 A T 8: 64,506,925 (GRCm39) Y605* probably null Het
Trim75 G A 8: 65,435,535 (GRCm39) P305L probably damaging Het
Unc13c T C 9: 73,838,166 (GRCm39) N895S probably benign Het
Vmn2r25 A T 6: 123,799,876 (GRCm39) I822N probably damaging Het
Wasf3 T G 5: 146,407,166 (GRCm39) D495E unknown Het
Wdhd1 T A 14: 47,510,667 (GRCm39) K119* probably null Het
Wnt2b T A 3: 104,858,339 (GRCm39) D310V probably damaging Het
Zfat G T 15: 68,052,626 (GRCm39) D389E probably damaging Het
Zfp282 G A 6: 47,857,102 (GRCm39) V112M probably damaging Het
Zfp617 A T 8: 72,687,257 (GRCm39) K529I probably damaging Het
Zfp866 A T 8: 70,218,373 (GRCm39) C416S probably damaging Het
Zfp991 G A 4: 147,264,222 (GRCm39) G533D probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139,599,546 (GRCm39) missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139,903,502 (GRCm39) missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7332:Pik3c2g UTSW 6 139,841,981 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9524:Pik3c2g UTSW 6 139,606,768 (GRCm39) missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF015:Pik3c2g UTSW 6 139,700,497 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGATTGTATCCTTCAGCTTCC -3'
(R):5'- GAGAGCCTCTCTGCATTAGAC -3'

Sequencing Primer
(F):5'- CCATGATATTTTTAAGAAAGTTCCCG -3'
(R):5'- GCATTAGACACTGTGTATCGC -3'
Posted On 2017-07-14