Incidental Mutation 'R6046:Herc1'
ID 483302
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission 044214-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6046 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 66257732-66416057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66352831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 2106 (M2106V)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042824
AA Change: M2106V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: M2106V

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186450
Meta Mutation Damage Score 0.3264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb3 T C 10: 85,223,947 (GRCm39) V252A unknown Het
Actn4 T C 7: 28,604,044 (GRCm39) I406V probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Ank1 T A 8: 23,606,114 (GRCm39) F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Atp9a C A 2: 168,476,790 (GRCm39) V1000L probably benign Het
Bnip3 A G 7: 138,511,033 (GRCm39) probably benign Het
Btnl6 T A 17: 34,727,371 (GRCm39) R386S probably damaging Het
Calcrl A G 2: 84,205,658 (GRCm39) V11A probably benign Het
Cc2d1a G T 8: 84,863,571 (GRCm39) A597D possibly damaging Het
Celsr3 A G 9: 108,714,350 (GRCm39) T1960A probably benign Het
Cfb T A 17: 35,081,078 (GRCm39) probably null Het
Chd8 A G 14: 52,458,528 (GRCm39) I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 (GRCm39) probably null Het
Crhr2 T A 6: 55,068,277 (GRCm39) T428S probably damaging Het
Crybg2 A T 4: 133,819,388 (GRCm39) I1753F probably damaging Het
Ctsq A T 13: 61,186,955 (GRCm39) V46E probably benign Het
Cxcr1 T C 1: 74,231,440 (GRCm39) E194G probably damaging Het
Dop1a A T 9: 86,397,396 (GRCm39) H900L probably damaging Het
Dpyd T A 3: 119,225,224 (GRCm39) M999K probably benign Het
Gbp3 A C 3: 142,273,560 (GRCm39) D369A possibly damaging Het
Glmp A G 3: 88,232,495 (GRCm39) E36G probably damaging Het
Gm10113 T C 13: 46,330,919 (GRCm39) noncoding transcript Het
Gm6486 T A 5: 3,120,846 (GRCm39) noncoding transcript Het
Gm973 T G 1: 59,671,509 (GRCm39) L891R unknown Het
Heatr3 C T 8: 88,866,582 (GRCm39) T8M probably damaging Het
Hfm1 A T 5: 107,046,509 (GRCm39) probably null Het
Hspa14 A G 2: 3,490,801 (GRCm39) V462A possibly damaging Het
Hspa5 C A 2: 34,665,761 (GRCm39) T535K possibly damaging Het
Ift140 A G 17: 25,274,563 (GRCm39) D745G probably benign Het
Ift27 A T 15: 78,057,981 (GRCm39) C8S possibly damaging Het
Irak1bp1 G A 9: 82,728,616 (GRCm39) W182* probably null Het
Itga3 A G 11: 94,953,541 (GRCm39) I236T probably benign Het
Kctd15 T A 7: 34,349,547 (GRCm39) N26Y possibly damaging Het
Kdm1b T C 13: 47,232,729 (GRCm39) V733A possibly damaging Het
Lhx8 A T 3: 154,027,340 (GRCm39) L234H probably damaging Het
Lrp2 T A 2: 69,337,098 (GRCm39) T1225S probably damaging Het
Lrrn1 G A 6: 107,545,488 (GRCm39) D429N probably benign Het
Mettl3 A T 14: 52,536,243 (GRCm39) N200K possibly damaging Het
Mixl1 G T 1: 180,524,336 (GRCm39) A81D possibly damaging Het
Mroh2b T C 15: 4,980,763 (GRCm39) I1444T probably benign Het
Muc15 T A 2: 110,561,786 (GRCm39) L74* probably null Het
Olfm2 T A 9: 20,579,824 (GRCm39) Y317F probably damaging Het
Or52a33 C T 7: 103,288,886 (GRCm39) V154M probably benign Het
Or5b114-ps1 G A 19: 13,352,698 (GRCm39) S124N probably benign Het
Or5p54 T A 7: 107,554,001 (GRCm39) I51N probably benign Het
Pclo A T 5: 14,763,302 (GRCm39) Y3925F unknown Het
Pik3c2g A T 6: 139,599,137 (GRCm39) R84S probably damaging Het
Pik3c2g A G 6: 139,842,518 (GRCm39) Q449R probably damaging Het
Psg28 T C 7: 18,160,305 (GRCm39) E297G probably damaging Het
Qrich2 A T 11: 116,337,832 (GRCm39) probably benign Het
Rgs9 A G 11: 109,130,386 (GRCm39) I363T probably damaging Het
Rnpepl1 A G 1: 92,844,543 (GRCm39) D345G probably damaging Het
Rtn4 T A 11: 29,658,023 (GRCm39) F726I probably damaging Het
Sart3 A T 5: 113,893,507 (GRCm39) I330N probably damaging Het
Scn5a T C 9: 119,391,440 (GRCm39) D84G probably damaging Het
Sema4a T C 3: 88,348,008 (GRCm39) T438A probably damaging Het
Sfxn1 A C 13: 54,242,961 (GRCm39) Y73S probably benign Het
Slc24a2 A G 4: 86,914,882 (GRCm39) M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 (GRCm39) V656A probably benign Het
Smok2a T G 17: 13,445,021 (GRCm39) D199E probably benign Het
Tbc1d10c T C 19: 4,235,030 (GRCm39) I344V probably benign Het
Tll1 A T 8: 64,506,925 (GRCm39) Y605* probably null Het
Trim75 G A 8: 65,435,535 (GRCm39) P305L probably damaging Het
Unc13c T C 9: 73,838,166 (GRCm39) N895S probably benign Het
Vmn2r25 A T 6: 123,799,876 (GRCm39) I822N probably damaging Het
Wasf3 T G 5: 146,407,166 (GRCm39) D495E unknown Het
Wdhd1 T A 14: 47,510,667 (GRCm39) K119* probably null Het
Wnt2b T A 3: 104,858,339 (GRCm39) D310V probably damaging Het
Zfat G T 15: 68,052,626 (GRCm39) D389E probably damaging Het
Zfp282 G A 6: 47,857,102 (GRCm39) V112M probably damaging Het
Zfp617 A T 8: 72,687,257 (GRCm39) K529I probably damaging Het
Zfp866 A T 8: 70,218,373 (GRCm39) C416S probably damaging Het
Zfp991 G A 4: 147,264,222 (GRCm39) G533D probably benign Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66,391,248 (GRCm39) missense probably benign 0.02
IGL00159:Herc1 APN 9 66,344,964 (GRCm39) missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66,383,402 (GRCm39) missense probably benign
IGL00717:Herc1 APN 9 66,392,284 (GRCm39) missense probably damaging 1.00
IGL00766:Herc1 APN 9 66,358,023 (GRCm39) missense probably damaging 1.00
IGL00776:Herc1 APN 9 66,328,320 (GRCm39) missense probably benign
IGL00987:Herc1 APN 9 66,315,334 (GRCm39) missense probably benign 0.07
IGL01090:Herc1 APN 9 66,376,457 (GRCm39) nonsense probably null
IGL01098:Herc1 APN 9 66,369,204 (GRCm39) critical splice donor site probably null
IGL01106:Herc1 APN 9 66,383,720 (GRCm39) splice site probably benign
IGL01120:Herc1 APN 9 66,336,162 (GRCm39) missense probably benign
IGL01359:Herc1 APN 9 66,346,550 (GRCm39) missense probably benign 0.01
IGL01360:Herc1 APN 9 66,390,981 (GRCm39) missense probably benign
IGL01364:Herc1 APN 9 66,306,643 (GRCm39) missense probably benign 0.00
IGL01470:Herc1 APN 9 66,404,918 (GRCm39) missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66,394,342 (GRCm39) missense probably damaging 1.00
IGL01825:Herc1 APN 9 66,307,089 (GRCm39) missense probably benign 0.00
IGL01903:Herc1 APN 9 66,294,154 (GRCm39) nonsense probably null
IGL01988:Herc1 APN 9 66,395,357 (GRCm39) splice site probably benign
IGL02074:Herc1 APN 9 66,358,265 (GRCm39) missense probably benign
IGL02089:Herc1 APN 9 66,388,151 (GRCm39) missense probably damaging 1.00
IGL02177:Herc1 APN 9 66,341,793 (GRCm39) missense probably benign
IGL02300:Herc1 APN 9 66,383,645 (GRCm39) missense probably benign 0.01
IGL02304:Herc1 APN 9 66,383,696 (GRCm39) missense probably benign 0.06
IGL02369:Herc1 APN 9 66,399,293 (GRCm39) nonsense probably null
IGL02445:Herc1 APN 9 66,340,764 (GRCm39) missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66,404,610 (GRCm39) missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66,307,183 (GRCm39) missense probably damaging 0.98
IGL02571:Herc1 APN 9 66,341,887 (GRCm39) splice site probably benign
IGL02709:Herc1 APN 9 66,404,962 (GRCm39) missense probably damaging 0.97
IGL02717:Herc1 APN 9 66,279,203 (GRCm39) nonsense probably null
IGL02726:Herc1 APN 9 66,349,270 (GRCm39) missense probably benign 0.37
IGL02733:Herc1 APN 9 66,358,274 (GRCm39) missense probably benign
IGL02963:Herc1 APN 9 66,296,105 (GRCm39) missense probably damaging 0.99
IGL03101:Herc1 APN 9 66,395,279 (GRCm39) missense probably benign
IGL03193:Herc1 APN 9 66,309,962 (GRCm39) missense probably benign
IGL03203:Herc1 APN 9 66,296,182 (GRCm39) critical splice donor site probably null
IGL03216:Herc1 APN 9 66,386,228 (GRCm39) missense probably benign 0.06
IGL03282:Herc1 APN 9 66,358,741 (GRCm39) missense probably benign 0.05
IGL03295:Herc1 APN 9 66,303,985 (GRCm39) missense possibly damaging 0.56
cradle UTSW 9 66,391,148 (GRCm39) splice site probably null
miracles UTSW 9 66,370,119 (GRCm39) nonsense probably null
newton UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
stables UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
strangle UTSW 9 66,408,470 (GRCm39) frame shift probably null
IGL03134:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66,279,489 (GRCm39) missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66,279,671 (GRCm39) missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66,386,291 (GRCm39) missense probably damaging 1.00
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0044:Herc1 UTSW 9 66,355,457 (GRCm39) missense probably benign 0.04
R0052:Herc1 UTSW 9 66,307,438 (GRCm39) missense probably damaging 0.99
R0114:Herc1 UTSW 9 66,369,128 (GRCm39) missense probably damaging 0.99
R0129:Herc1 UTSW 9 66,355,357 (GRCm39) missense probably damaging 1.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0131:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0132:Herc1 UTSW 9 66,388,192 (GRCm39) missense probably benign 0.00
R0158:Herc1 UTSW 9 66,403,203 (GRCm39) nonsense probably null
R0333:Herc1 UTSW 9 66,371,981 (GRCm39) splice site probably null
R0384:Herc1 UTSW 9 66,388,332 (GRCm39) splice site probably benign
R0419:Herc1 UTSW 9 66,353,356 (GRCm39) splice site probably benign
R0453:Herc1 UTSW 9 66,307,054 (GRCm39) missense probably benign 0.20
R0458:Herc1 UTSW 9 66,383,663 (GRCm39) missense probably benign 0.12
R0490:Herc1 UTSW 9 66,392,281 (GRCm39) missense probably damaging 1.00
R0506:Herc1 UTSW 9 66,355,441 (GRCm39) missense probably damaging 0.99
R0513:Herc1 UTSW 9 66,352,927 (GRCm39) missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66,358,163 (GRCm39) missense probably benign 0.35
R0666:Herc1 UTSW 9 66,392,170 (GRCm39) splice site probably benign
R0674:Herc1 UTSW 9 66,408,474 (GRCm39) missense probably damaging 0.99
R0682:Herc1 UTSW 9 66,389,263 (GRCm39) missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66,294,120 (GRCm39) nonsense probably null
R0701:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R0766:Herc1 UTSW 9 66,412,122 (GRCm39) missense probably damaging 1.00
R0850:Herc1 UTSW 9 66,373,952 (GRCm39) missense probably damaging 1.00
R0907:Herc1 UTSW 9 66,340,710 (GRCm39) missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66,279,427 (GRCm39) missense probably damaging 1.00
R0976:Herc1 UTSW 9 66,347,160 (GRCm39) missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66,363,250 (GRCm39) missense probably benign
R1200:Herc1 UTSW 9 66,393,406 (GRCm39) missense probably damaging 1.00
R1226:Herc1 UTSW 9 66,323,545 (GRCm39) missense probably benign 0.00
R1364:Herc1 UTSW 9 66,307,375 (GRCm39) missense probably damaging 1.00
R1395:Herc1 UTSW 9 66,346,463 (GRCm39) missense probably benign 0.13
R1432:Herc1 UTSW 9 66,372,751 (GRCm39) missense probably benign 0.13
R1440:Herc1 UTSW 9 66,375,085 (GRCm39) missense probably damaging 1.00
R1476:Herc1 UTSW 9 66,415,548 (GRCm39) missense probably damaging 1.00
R1590:Herc1 UTSW 9 66,399,235 (GRCm39) splice site probably benign
R1634:Herc1 UTSW 9 66,380,820 (GRCm39) missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66,357,960 (GRCm39) splice site probably null
R1753:Herc1 UTSW 9 66,409,366 (GRCm39) critical splice donor site probably null
R1753:Herc1 UTSW 9 66,376,292 (GRCm39) missense probably damaging 1.00
R1796:Herc1 UTSW 9 66,296,138 (GRCm39) nonsense probably null
R1830:Herc1 UTSW 9 66,404,881 (GRCm39) missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66,298,708 (GRCm39) missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66,358,073 (GRCm39) missense probably damaging 1.00
R1894:Herc1 UTSW 9 66,386,743 (GRCm39) missense probably damaging 1.00
R1918:Herc1 UTSW 9 66,383,408 (GRCm39) splice site probably null
R1999:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R2034:Herc1 UTSW 9 66,349,254 (GRCm39) missense probably benign 0.01
R2138:Herc1 UTSW 9 66,377,589 (GRCm39) missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66,347,183 (GRCm39) missense probably benign 0.45
R2192:Herc1 UTSW 9 66,372,688 (GRCm39) missense probably damaging 0.99
R2312:Herc1 UTSW 9 66,415,563 (GRCm39) nonsense probably null
R2338:Herc1 UTSW 9 66,336,251 (GRCm39) missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66,391,217 (GRCm39) missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3732:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3733:Herc1 UTSW 9 66,352,922 (GRCm39) missense probably damaging 1.00
R3917:Herc1 UTSW 9 66,341,748 (GRCm39) missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66,341,075 (GRCm39) nonsense probably null
R4073:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4075:Herc1 UTSW 9 66,325,774 (GRCm39) missense probably benign 0.12
R4241:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4260:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4261:Herc1 UTSW 9 66,355,630 (GRCm39) frame shift probably null
R4300:Herc1 UTSW 9 66,396,688 (GRCm39) missense probably damaging 1.00
R4398:Herc1 UTSW 9 66,386,735 (GRCm39) missense probably benign 0.13
R4426:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4427:Herc1 UTSW 9 66,403,287 (GRCm39) missense probably damaging 1.00
R4590:Herc1 UTSW 9 66,344,946 (GRCm39) missense probably damaging 0.97
R4630:Herc1 UTSW 9 66,340,996 (GRCm39) splice site probably null
R4656:Herc1 UTSW 9 66,301,993 (GRCm39) missense probably damaging 0.97
R4658:Herc1 UTSW 9 66,386,773 (GRCm39) missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66,340,660 (GRCm39) missense probably damaging 0.98
R4675:Herc1 UTSW 9 66,298,740 (GRCm39) missense probably damaging 1.00
R4678:Herc1 UTSW 9 66,323,551 (GRCm39) missense probably benign 0.00
R4754:Herc1 UTSW 9 66,408,488 (GRCm39) missense probably benign 0.00
R4766:Herc1 UTSW 9 66,349,211 (GRCm39) missense probably benign 0.00
R4792:Herc1 UTSW 9 66,403,266 (GRCm39) missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66,404,625 (GRCm39) splice site probably null
R4832:Herc1 UTSW 9 66,403,253 (GRCm39) missense probably benign 0.11
R4879:Herc1 UTSW 9 66,370,119 (GRCm39) nonsense probably null
R4948:Herc1 UTSW 9 66,392,184 (GRCm39) missense probably benign
R5021:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66,393,408 (GRCm39) missense probably benign 0.03
R5027:Herc1 UTSW 9 66,380,811 (GRCm39) missense probably benign 0.01
R5027:Herc1 UTSW 9 66,411,900 (GRCm39) missense probably damaging 0.98
R5038:Herc1 UTSW 9 66,383,742 (GRCm39) intron probably benign
R5041:Herc1 UTSW 9 66,336,327 (GRCm39) missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66,377,608 (GRCm39) missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66,355,505 (GRCm39) missense probably benign
R5197:Herc1 UTSW 9 66,355,786 (GRCm39) missense probably damaging 0.99
R5207:Herc1 UTSW 9 66,307,151 (GRCm39) nonsense probably null
R5247:Herc1 UTSW 9 66,341,833 (GRCm39) missense probably benign 0.01
R5267:Herc1 UTSW 9 66,369,091 (GRCm39) missense probably damaging 1.00
R5274:Herc1 UTSW 9 66,306,691 (GRCm39) missense probably benign
R5375:Herc1 UTSW 9 66,375,169 (GRCm39) missense probably damaging 0.99
R5401:Herc1 UTSW 9 66,409,338 (GRCm39) missense probably damaging 1.00
R5560:Herc1 UTSW 9 66,358,401 (GRCm39) missense probably benign 0.02
R5566:Herc1 UTSW 9 66,372,819 (GRCm39) missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66,389,263 (GRCm39) missense probably damaging 0.99
R5596:Herc1 UTSW 9 66,341,345 (GRCm39) critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66,372,717 (GRCm39) missense probably damaging 1.00
R5744:Herc1 UTSW 9 66,415,475 (GRCm39) missense probably damaging 1.00
R5802:Herc1 UTSW 9 66,370,160 (GRCm39) missense probably damaging 1.00
R5822:Herc1 UTSW 9 66,352,894 (GRCm39) missense probably benign 0.00
R5954:Herc1 UTSW 9 66,358,774 (GRCm39) splice site probably benign
R5977:Herc1 UTSW 9 66,340,604 (GRCm39) missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66,390,967 (GRCm39) missense probably damaging 1.00
R6043:Herc1 UTSW 9 66,315,436 (GRCm39) missense probably benign
R6089:Herc1 UTSW 9 66,352,814 (GRCm39) missense probably damaging 1.00
R6123:Herc1 UTSW 9 66,404,532 (GRCm39) missense probably damaging 0.97
R6155:Herc1 UTSW 9 66,340,705 (GRCm39) missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66,283,663 (GRCm39) missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66,341,070 (GRCm39) missense probably damaging 1.00
R6265:Herc1 UTSW 9 66,279,298 (GRCm39) missense probably benign 0.05
R6348:Herc1 UTSW 9 66,395,258 (GRCm39) missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66,379,190 (GRCm39) missense probably damaging 1.00
R6394:Herc1 UTSW 9 66,302,341 (GRCm39) missense probably damaging 0.99
R6434:Herc1 UTSW 9 66,393,464 (GRCm39) missense probably damaging 0.99
R6483:Herc1 UTSW 9 66,355,811 (GRCm39) missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66,325,849 (GRCm39) missense probably benign 0.02
R6633:Herc1 UTSW 9 66,346,534 (GRCm39) nonsense probably null
R6634:Herc1 UTSW 9 66,345,026 (GRCm39) missense probably benign
R6693:Herc1 UTSW 9 66,386,258 (GRCm39) missense probably damaging 0.99
R6695:Herc1 UTSW 9 66,391,148 (GRCm39) splice site probably null
R6748:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6750:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6751:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6774:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6785:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6786:Herc1 UTSW 9 66,408,470 (GRCm39) frame shift probably null
R6856:Herc1 UTSW 9 66,305,180 (GRCm39) missense probably benign 0.05
R6966:Herc1 UTSW 9 66,318,347 (GRCm39) missense probably benign 0.07
R7020:Herc1 UTSW 9 66,393,360 (GRCm39) missense probably benign 0.07
R7109:Herc1 UTSW 9 66,389,171 (GRCm39) missense probably benign 0.03
R7122:Herc1 UTSW 9 66,307,056 (GRCm39) missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66,292,314 (GRCm39) missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66,374,781 (GRCm39) missense probably damaging 0.98
R7303:Herc1 UTSW 9 66,358,098 (GRCm39) missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66,369,150 (GRCm39) missense
R7438:Herc1 UTSW 9 66,302,038 (GRCm39) missense probably benign 0.00
R7535:Herc1 UTSW 9 66,382,135 (GRCm39) missense probably damaging 1.00
R7585:Herc1 UTSW 9 66,352,829 (GRCm39) missense probably damaging 1.00
R7603:Herc1 UTSW 9 66,358,665 (GRCm39) nonsense probably null
R7670:Herc1 UTSW 9 66,323,629 (GRCm39) missense probably damaging 0.99
R7705:Herc1 UTSW 9 66,347,116 (GRCm39) missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66,279,158 (GRCm39) missense probably benign 0.24
R7730:Herc1 UTSW 9 66,400,472 (GRCm39) small deletion probably benign
R7880:Herc1 UTSW 9 66,415,506 (GRCm39) missense probably damaging 0.99
R7958:Herc1 UTSW 9 66,393,475 (GRCm39) missense probably damaging 1.00
R7976:Herc1 UTSW 9 66,341,552 (GRCm39) missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66,352,842 (GRCm39) nonsense probably null
R8084:Herc1 UTSW 9 66,383,217 (GRCm39) missense probably benign 0.45
R8094:Herc1 UTSW 9 66,400,462 (GRCm39) missense probably damaging 0.98
R8099:Herc1 UTSW 9 66,279,422 (GRCm39) missense probably damaging 1.00
R8151:Herc1 UTSW 9 66,341,073 (GRCm39) missense probably damaging 0.98
R8159:Herc1 UTSW 9 66,369,003 (GRCm39) missense probably null
R8190:Herc1 UTSW 9 66,325,733 (GRCm39) missense probably benign 0.00
R8213:Herc1 UTSW 9 66,358,170 (GRCm39) missense probably damaging 0.99
R8230:Herc1 UTSW 9 66,377,598 (GRCm39) missense probably damaging 0.99
R8265:Herc1 UTSW 9 66,293,986 (GRCm39) nonsense probably null
R8270:Herc1 UTSW 9 66,395,232 (GRCm39) missense probably damaging 1.00
R8353:Herc1 UTSW 9 66,415,571 (GRCm39) missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66,415,442 (GRCm39) missense probably damaging 0.99
R8506:Herc1 UTSW 9 66,380,863 (GRCm39) missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66,358,224 (GRCm39) missense probably benign
R8530:Herc1 UTSW 9 66,325,910 (GRCm39) missense probably benign
R8545:Herc1 UTSW 9 66,279,257 (GRCm39) nonsense probably null
R8682:Herc1 UTSW 9 66,370,130 (GRCm39) missense
R8720:Herc1 UTSW 9 66,389,105 (GRCm39) missense probably benign 0.38
R8792:Herc1 UTSW 9 66,372,768 (GRCm39) missense probably damaging 1.00
R8915:Herc1 UTSW 9 66,318,456 (GRCm39) missense probably damaging 1.00
R8964:Herc1 UTSW 9 66,352,872 (GRCm39) missense probably damaging 1.00
R9056:Herc1 UTSW 9 66,380,782 (GRCm39) missense probably benign 0.10
R9158:Herc1 UTSW 9 66,376,400 (GRCm39) missense probably benign 0.00
R9167:Herc1 UTSW 9 66,411,900 (GRCm39) missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66,321,413 (GRCm39) missense probably benign 0.35
R9252:Herc1 UTSW 9 66,309,834 (GRCm39) missense probably damaging 1.00
R9260:Herc1 UTSW 9 66,325,691 (GRCm39) nonsense probably null
R9261:Herc1 UTSW 9 66,412,129 (GRCm39) missense probably damaging 0.98
R9430:Herc1 UTSW 9 66,325,785 (GRCm39) nonsense probably null
R9519:Herc1 UTSW 9 66,307,356 (GRCm39) missense probably damaging 0.97
R9563:Herc1 UTSW 9 66,294,193 (GRCm39) critical splice donor site probably null
R9589:Herc1 UTSW 9 66,372,840 (GRCm39) missense possibly damaging 0.95
R9600:Herc1 UTSW 9 66,304,594 (GRCm39) missense possibly damaging 0.95
R9659:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
R9740:Herc1 UTSW 9 66,355,796 (GRCm39) missense probably damaging 1.00
R9774:Herc1 UTSW 9 66,372,032 (GRCm39) missense probably null
R9781:Herc1 UTSW 9 66,280,004 (GRCm39) missense probably benign
R9788:Herc1 UTSW 9 66,307,185 (GRCm39) missense probably benign 0.03
RF023:Herc1 UTSW 9 66,365,616 (GRCm39) missense
X0011:Herc1 UTSW 9 66,307,441 (GRCm39) missense probably benign 0.28
X0067:Herc1 UTSW 9 66,355,806 (GRCm39) missense probably benign 0.03
Z1176:Herc1 UTSW 9 66,341,858 (GRCm39) missense probably benign
Z1177:Herc1 UTSW 9 66,379,193 (GRCm39) missense probably damaging 0.99
Z1177:Herc1 UTSW 9 66,365,707 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCAATGTAGTAATAGCACACAG -3'
(R):5'- CACTTTTCTGTAAGGTTGGCACTG -3'

Sequencing Primer
(F):5'- GAGGTAATGAAGGTACATGTGT -3'
(R):5'- AGTAAAGCTGGACAGCGT -3'
Posted On 2017-07-14