Incidental Mutation 'R6046:Unc13c'
ID483303
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73930884 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 895 (N895S)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: N895S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: N895S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: N895S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: N895S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGAAGGAAGGCCTGATTCTC -3'
(R):5'- ACCGCGAACGAGTCAAGTAC -3'

Sequencing Primer
(F):5'- ATGACCTCCAGTGACTCTGCAG -3'
(R):5'- CGAGTCAAGTACCACCCTTG -3'
Posted On2017-07-14