Incidental Mutation 'R6047:Tldc2'
ID483333
Institutional Source Beutler Lab
Gene Symbol Tldc2
Ensembl Gene ENSMUSG00000074628
Gene NameTBC/LysM associated domain containing 2
SynonymsGm1332, LOC383766
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6047 (G1)
Quality Score198.009
Status Validated
Chromosome2
Chromosomal Location157087055-157096482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157096462 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 207 (E207G)
Ref Sequence ENSEMBL: ENSMUSP00000129278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057725] [ENSMUST00000088523] [ENSMUST00000099140] [ENSMUST00000123932] [ENSMUST00000166140]
Predicted Effect probably benign
Transcript: ENSMUST00000057725
SMART Domains Protein: ENSMUSP00000059717
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 1e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088523
SMART Domains Protein: ENSMUSP00000085880
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
SAM 74 142 4.4e-14 SMART
HDc 192 357 1.89e-9 SMART
Blast:HDc 398 437 2e-16 BLAST
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099140
AA Change: E193G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096743
Gene: ENSMUSG00000074628
AA Change: E193G

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
TLDc 36 198 8.47e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123932
SMART Domains Protein: ENSMUSP00000124599
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SAM 43 112 1.51e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139263
SMART Domains Protein: ENSMUSP00000124935
Gene: ENSMUSG00000027639

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
SAM 54 122 4.4e-14 SMART
HDc 172 337 1.89e-9 SMART
Blast:HDc 378 417 2e-16 BLAST
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166140
AA Change: E207G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129278
Gene: ENSMUSG00000074628
AA Change: E207G

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
TLDc 50 212 8.47e-58 SMART
Meta Mutation Damage Score 0.9161 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Tldc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0376:Tldc2 UTSW 2 157095305 missense probably damaging 1.00
R6953:Tldc2 UTSW 2 157089278 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCATTGAAGCGGCCTAGGC -3'
(R):5'- GTGCATACACCCGACTTGAC -3'

Sequencing Primer
(F):5'- CGTGCCCGAGTAACAGACATTG -3'
(R):5'- GCATACACCCGACTTGACTTAATATG -3'
Posted On2017-07-14