Incidental Mutation 'R6047:Stmn3'
ID483334
Institutional Source Beutler Lab
Gene Symbol Stmn3
Ensembl Gene ENSMUSG00000027581
Gene Namestathmin-like 3
SynonymsSclip, 9330161A03Rik
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R6047 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181306459-181314500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181309159 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 35 (Y35N)
Ref Sequence ENSEMBL: ENSMUSP00000099334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103045
AA Change: Y35N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099334
Gene: ENSMUSG00000027581
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:Stathmin 41 175 2.7e-56 PFAM
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the stathmin protein family. Members of this protein family form a complex with tubulins at a ratio of 2 tubulins for each stathmin protein. Microtubules require the ordered assembly of alpha- and beta-tubulins, and formation of a complex with stathmin disrupts microtubule formation and function. A pseudogene of this gene is located on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Stmn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
Translucent UTSW 2 181308780 missense possibly damaging 0.81
IGL03147:Stmn3 UTSW 2 181309200 missense possibly damaging 0.63
R1916:Stmn3 UTSW 2 181307280 missense possibly damaging 0.86
R4113:Stmn3 UTSW 2 181307296 missense possibly damaging 0.87
R4391:Stmn3 UTSW 2 181308783 missense probably benign 0.11
R4910:Stmn3 UTSW 2 181308837 missense probably damaging 0.99
R5903:Stmn3 UTSW 2 181308780 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGTTTGGGCATACAGGCAG -3'
(R):5'- TATGCACATAGATAAAGGCCACTGTAG -3'

Sequencing Primer
(F):5'- CAGGATGAGAGGTTTATTTCCAGCAC -3'
(R):5'- GGCCACTGTAGAATACAAAGACCTAG -3'
Posted On2017-07-14