Incidental Mutation 'R6047:Lce1j'
ID483336
Institutional Source Beutler Lab
Gene Symbol Lce1j
Ensembl Gene ENSMUSG00000068887
Gene Namelate cornified envelope 1J
SynonymsSprrl8
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6047 (G1)
Quality Score200.009
Status Validated
Chromosome3
Chromosomal Location92788840-92790514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 92789196 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 92 (R92G)
Ref Sequence ENSEMBL: ENSMUSP00000140507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107304] [ENSMUST00000186525]
Predicted Effect unknown
Transcript: ENSMUST00000107304
AA Change: R92G
SMART Domains Protein: ENSMUSP00000102925
Gene: ENSMUSG00000068887
AA Change: R92G

DomainStartEndE-ValueType
Pfam:LCE 21 63 5e-12 PFAM
Pfam:LCE 60 125 1.1e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186525
AA Change: R92G
SMART Domains Protein: ENSMUSP00000140507
Gene: ENSMUSG00000068887
AA Change: R92G

DomainStartEndE-ValueType
Pfam:LCE 21 63 4.2e-10 PFAM
Pfam:LCE 60 126 8.5e-10 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Lce1j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Lce1j APN 3 92789406 missense unknown
R0386:Lce1j UTSW 3 92789388 missense unknown
R6155:Lce1j UTSW 3 92789072 missense unknown
R6468:Lce1j UTSW 3 92789422 nonsense probably null
R6844:Lce1j UTSW 3 92789349 missense unknown
R7156:Lce1j UTSW 3 92789184 missense unknown
R7953:Lce1j UTSW 3 92789083 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGTCTTCCTCACCCAG -3'
(R):5'- GCCAAGTGTCCTCCAAAATGC -3'

Sequencing Primer
(F):5'- GAAGTCTTCCTCACCCAGGTCAG -3'
(R):5'- AGTGTCCCCCAAAATGTCCTC -3'
Posted On2017-07-14