Incidental Mutation 'R6047:Abcb1b'
ID483338
Institutional Source Beutler Lab
Gene Symbol Abcb1b
Ensembl Gene ENSMUSG00000028970
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1B
SynonymsPgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b
MMRRC Submission 044215-MU
Accession Numbers

Genbank: NM_011075; MGI: 97568  

Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R6047 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8798147-8866315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8806066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000143766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000196580] [ENSMUST00000199955]
Predicted Effect probably benign
Transcript: ENSMUST00000009058
AA Change: I58T

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 342 1.4e-96 PFAM
AAA 418 610 4.32e-21 SMART
Pfam:ABC_membrane 709 984 1.9e-75 PFAM
AAA 1060 1248 4.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196580
AA Change: I58T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143612
Gene: ENSMUSG00000028970
AA Change: I58T

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000199955
AA Change: I58T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970
AA Change: I58T

DomainStartEndE-ValueType
PDB:4M2T|B 1 78 2e-26 PDB
Blast:AAA 33 78 2e-11 BLAST
Meta Mutation Damage Score 0.3669 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Nt5c3 G A 6: 56,882,979 S291L probably damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Abcb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Abcb1b APN 5 8827704 missense probably benign 0.34
IGL00979:Abcb1b APN 5 8825293 splice site probably benign
IGL02157:Abcb1b APN 5 8805487 splice site probably benign
IGL02478:Abcb1b APN 5 8806018 missense probably damaging 0.98
IGL03174:Abcb1b APN 5 8827752 missense probably benign 0.03
IGL03189:Abcb1b APN 5 8845814 missense probably benign
IGL03195:Abcb1b APN 5 8853607 missense possibly damaging 0.83
PIT4283001:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R0049:Abcb1b UTSW 5 8825661 missense probably damaging 1.00
R0166:Abcb1b UTSW 5 8853468 missense probably damaging 1.00
R0254:Abcb1b UTSW 5 8827409 missense probably benign
R0319:Abcb1b UTSW 5 8827428 missense probably benign 0.01
R0358:Abcb1b UTSW 5 8821423 missense probably benign 0.16
R0365:Abcb1b UTSW 5 8806009 missense probably damaging 1.00
R0408:Abcb1b UTSW 5 8853446 missense probably damaging 0.98
R0521:Abcb1b UTSW 5 8864238 missense probably damaging 1.00
R0533:Abcb1b UTSW 5 8864113 critical splice acceptor site probably null
R0847:Abcb1b UTSW 5 8845764 missense probably damaging 0.99
R1037:Abcb1b UTSW 5 8825657 missense probably benign 0.03
R1432:Abcb1b UTSW 5 8837771 missense possibly damaging 0.69
R1437:Abcb1b UTSW 5 8821436 missense possibly damaging 0.90
R1520:Abcb1b UTSW 5 8814768 missense probably damaging 1.00
R1686:Abcb1b UTSW 5 8798782 missense probably damaging 0.97
R1700:Abcb1b UTSW 5 8849537 missense probably benign 0.44
R1973:Abcb1b UTSW 5 8812746 missense probably benign 0.01
R1993:Abcb1b UTSW 5 8821322 missense possibly damaging 0.61
R2157:Abcb1b UTSW 5 8824791 missense probably benign 0.37
R2207:Abcb1b UTSW 5 8824803 missense probably benign 0.23
R2968:Abcb1b UTSW 5 8861485 missense probably damaging 1.00
R3858:Abcb1b UTSW 5 8813581 missense probably benign 0.11
R4223:Abcb1b UTSW 5 8813722 missense probably damaging 0.97
R4379:Abcb1b UTSW 5 8865875 missense probably benign 0.00
R4674:Abcb1b UTSW 5 8810615 missense probably benign
R4964:Abcb1b UTSW 5 8812671 missense probably benign 0.00
R4964:Abcb1b UTSW 5 8861602 missense probably damaging 1.00
R5167:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R5216:Abcb1b UTSW 5 8813705 missense probably benign 0.04
R5328:Abcb1b UTSW 5 8837694 missense possibly damaging 0.69
R5391:Abcb1b UTSW 5 8805481 missense probably null 0.00
R5399:Abcb1b UTSW 5 8827410 missense probably benign
R6157:Abcb1b UTSW 5 8824245 missense possibly damaging 0.81
R6293:Abcb1b UTSW 5 8853493 missense probably benign 0.05
R6493:Abcb1b UTSW 5 8824698 missense probably damaging 1.00
R6593:Abcb1b UTSW 5 8853491 missense probably benign
R6799:Abcb1b UTSW 5 8812656 missense probably damaging 0.98
R6944:Abcb1b UTSW 5 8813693 missense probably damaging 1.00
R7028:Abcb1b UTSW 5 8805441 missense probably damaging 0.99
R7227:Abcb1b UTSW 5 8825593 missense probably damaging 1.00
R7495:Abcb1b UTSW 5 8865871 missense probably damaging 1.00
R7573:Abcb1b UTSW 5 8828866 missense possibly damaging 0.80
R7681:Abcb1b UTSW 5 8849619 missense probably benign 0.00
R7827:Abcb1b UTSW 5 8837747 missense probably damaging 0.96
R7860:Abcb1b UTSW 5 8832258 missense probably benign 0.12
R7943:Abcb1b UTSW 5 8832258 missense probably benign 0.12
R8009:Abcb1b UTSW 5 8828870 missense possibly damaging 0.65
R8054:Abcb1b UTSW 5 8824272 missense probably benign
X0025:Abcb1b UTSW 5 8824515 missense possibly damaging 0.91
X0061:Abcb1b UTSW 5 8864269 splice site probably null
Z1176:Abcb1b UTSW 5 8827441 missense probably benign
Z1177:Abcb1b UTSW 5 8837596 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTTGAACACAGCAGAGG -3'
(R):5'- AACCTGAATGAGAGCGCTG -3'

Sequencing Primer
(F):5'- GGAGAGCACAGCCTGGTG -3'
(R):5'- TGCACATTTGGTAAAGGCCC -3'
Posted On2017-07-14