Incidental Mutation 'R6047:Nt5c3'
ID483339
Institutional Source Beutler Lab
Gene Symbol Nt5c3
Ensembl Gene ENSMUSG00000029780
Gene Name5'-nucleotidase, cytosolic III
SynonymsUmph1, 2610206B05Rik, PN-1, p36, lupin, cN-III, 1600024P05Rik, PSN1, Umph-1, PN-I
MMRRC Submission 044215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6047 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location56882400-56923932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56882979 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 291 (S291L)
Ref Sequence ENSEMBL: ENSMUSP00000098918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031793] [ENSMUST00000031795] [ENSMUST00000101367] [ENSMUST00000135558] [ENSMUST00000152447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031793
AA Change: S325L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031793
Gene: ENSMUSG00000029780
AA Change: S325L

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:UMPH-1 86 331 5.6e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031795
SMART Domains Protein: ENSMUSP00000031795
Gene: ENSMUSG00000029781

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FKBP_C 47 139 8.2e-31 PFAM
Pfam:FKBP_C 159 251 5.8e-28 PFAM
Pfam:FKBP_C 271 362 1.3e-27 PFAM
Pfam:FKBP_C 382 474 2.8e-27 PFAM
EFh 492 520 2.35e0 SMART
EFh 537 565 1.98e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101367
AA Change: S291L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098918
Gene: ENSMUSG00000029780
AA Change: S291L

DomainStartEndE-ValueType
Pfam:UMPH-1 52 297 2.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126137
Predicted Effect probably benign
Transcript: ENSMUST00000135558
SMART Domains Protein: ENSMUSP00000145230
Gene: ENSMUSG00000029780

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152447
Predicted Effect probably benign
Transcript: ENSMUST00000205087
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,806,066 I58T probably damaging Het
Adgrb2 G T 4: 130,018,705 G1208C probably damaging Het
Antxrl T C 14: 34,053,476 probably benign Het
Appl2 C T 10: 83,612,901 probably null Het
Bloc1s2 T C 19: 44,142,190 I112V possibly damaging Het
Cblb G T 16: 52,112,248 probably null Het
Cdk9 T C 2: 32,708,273 probably null Het
Dok7 G A 5: 35,079,307 G206D probably damaging Het
Ftsj3 C T 11: 106,252,318 R390H probably damaging Het
Gpr179 G T 11: 97,338,416 P971Q probably damaging Het
Hic1 A T 11: 75,166,849 S405T possibly damaging Het
Ifngr1 T C 10: 19,606,313 L217P probably damaging Het
Insrr A G 3: 87,804,176 K468E probably damaging Het
Lce1j G C 3: 92,789,196 R92G unknown Het
Lrp12 T C 15: 39,872,067 E823G probably damaging Het
Lrp1b A G 2: 40,637,775 I98T probably benign Het
Mbd3l2 A T 9: 18,444,916 H179L possibly damaging Het
Med24 A T 11: 98,707,765 C691* probably null Het
Mical1 T C 10: 41,481,707 probably null Het
Msantd2 A T 9: 37,523,442 Y326F probably damaging Het
Nfyc T A 4: 120,779,117 probably null Het
Nrg3 T A 14: 38,397,352 probably null Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pdia5 T C 16: 35,397,478 K512E probably damaging Het
Pfpl T C 19: 12,429,233 F283L probably damaging Het
Pick1 A G 15: 79,255,695 probably benign Het
Pkd1 T C 17: 24,595,085 V4143A probably damaging Het
Ptprc C T 1: 138,101,041 probably null Het
Scn10a A G 9: 119,622,831 F1342S probably benign Het
Slc17a7 A T 7: 45,173,406 I436F probably benign Het
Slc34a1 G T 13: 55,412,071 A403S probably damaging Het
Stmn3 A T 2: 181,309,159 Y35N possibly damaging Het
Tldc2 A G 2: 157,096,462 E207G probably damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Uty G T Y: 1,158,288 P538Q probably damaging Het
Zzef1 A G 11: 72,866,095 D1142G probably damaging Het
Other mutations in Nt5c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Nt5c3 APN 6 56886685 missense probably damaging 1.00
IGL02819:Nt5c3 APN 6 56883733 missense probably damaging 1.00
R0426:Nt5c3 UTSW 6 56883812 missense probably benign
R0523:Nt5c3 UTSW 6 56883681 missense probably damaging 1.00
R0791:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R0792:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R1340:Nt5c3 UTSW 6 56883033 missense probably benign 0.02
R3703:Nt5c3 UTSW 6 56883667 unclassified probably benign
R5942:Nt5c3 UTSW 6 56897854 intron probably null
R6894:Nt5c3 UTSW 6 56882973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCACACGTCTGAAGATCG -3'
(R):5'- CTGTCCATGATAAGTCTGAGAGTG -3'

Sequencing Primer
(F):5'- CACACGTCTGAAGATCGTCTGTTG -3'
(R):5'- CCAGCGATCATGATGCTGAG -3'
Posted On2017-07-14